Labshake search
Citations for Roche :
3901 - 3950 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... they were digested with DNAse I (30 IU/mL, Roche) and Collagenase D (1 mg/mL ...
-
bioRxiv - Immunology 2023Quote: ... minced thymuses were digested with 0.5 unit/ml Liberase (Roche) in the presence of 0.02% DNase I (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.01 mg/mL of human insulin (Roche, Indianapolis, IN, USA), 10 mM HEPES (Corning ...
-
bioRxiv - Biochemistry 2023Quote: ... 8.4 U/mL pyruvate kinase (Roche Diagnostics GmbH, Mannheim, Germany), 0.1 mg/mL BSA and 200 mM NADH ...
-
bioRxiv - Immunology 2023Quote: ... Freshly prepared 100µl Liberase TL (2mg/mL stock, Roche Diagnostics) + 700μl of Tyrode’s solution was added to the tissues and incubated for 15 min at 37°C and tissue was dispersed through a 70μm cell strainer (Falcon).
-
bioRxiv - Biochemistry 2023Quote: ... 15 U/mL lactate dehydrogenase (Roche Diagnostics GmbH, Mannheim, Germany), 8.4 U/mL pyruvate kinase (Roche Diagnostics GmbH ...
-
bioRxiv - Biophysics 2023Quote: 10 µg/mL mouse anti-GFP (Roche. Cat no. 11814460001) in PBS was incubated on a tunnel slide for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... and 50µl Liberase DH (Roche Cat No. 12352200, 2.5mg/ml) was added to each sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (194 μg/ml, recombinant, PCR grade, Roche) for 2 hours at 56 °C to achieve cell lysis and protein digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µg/mL dornase alfa (Pulmozyme®, Roche, Basel, Switzerland) and 1 mg/mL collagenase IV (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Residual DNA was digested with 10µg/mL DNase I (Roche) and denuded matrices were then washed and stored in D-PBS with 100U/mL penicillin/streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... Tissue was digested with 0.5 mg/ml DNAse I (Roche) and 0.25 mg/ml Liberase TM (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2 mg/mL RNase-free bovine serum albumin (Roche Diagnostics), 10% Dextran sulfate (MP Biomedicals) ...
-
bioRxiv - Immunology 2024Quote: ... with DNAse I 0,1mg/ml (Roche 11-284-932-001) and Liberase® 0,1 mg/ml (Roche 05-401-020-001).
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biochemistry 2019Quote: ... and the resulting duplex was captured on 3 mg streptavidin-coated magnetic beads (Roche, rotation for 2 h at 37°C). After extraction with phenol-chloroform and precipitation with ethanol ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor). The homogenate was centrifuged and the protein concentration of the supernatant was measured using a Pierce 660 nm Protein Assay Reagent (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... and a 30-gauge needle was used to inflate each pancreas through the common bile duct with 4 mL of media supplemented with 0.8 mg/mL of collagenase P (Roche, cat. number 11-249-002-001) and filtered at 0.22 μm prior to injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... The pellet was resuspended in Buffer A (10mM Tris pH 8.0; 10mM KCL; 0.25% Triton-X-100; 1mM EDTA; 0.5mM EGTA; 1X protease inhibitor cocktail from Roche), and incubated on ice for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were fixed with 4%PFA and 100 μl of Annexin-V-Alexa 568 labeling solution (Roche) and 50 μM Sytox Green dye (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells bound to the beads were resuspended in 100 μL buffer (20 mM HEPES pH 7.5, 0.15 M NaCl, 0.5 mM Spermidine, 1x Roche complete protease inhibitors ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 5mM EDTA and 0.003% Triton X-100) with protease inhibitor (cOmplete Mini, EDTA-free, ROCHE, Sussex, UK). After 30mins incubation at 4°C extracts were centrifuged at 13,000rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% blocking buffer pH 7.5 (100 mM maleic acid, 150 mM NaCl, 10% Roche blocking reagent #11096176001). Antibody staining was performed in 3% BSA in PBS-Triton (0.1%) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 7.9, 10mM KCl, 0.1% Triton X-100, 20% Glycerol, 0.5 mM Spermidine supplemented with 1x Roche cOmplete mini ...
-
bioRxiv - Microbiology 2021Quote: ... The Triton X-100-soluble fraction (input) was incubated with anti-HA agarose beads (Roche product ROAHAHA) overnight at 4°C and was washed five times with IP buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 mM NaF and 0.1% Triton X-100) freshly supplemented with Protease Inhibitor Cocktail and Phostop (Roche). Lysates were centrifuged at 4000 rpm for 4 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were lysed by bead beating after resuspension in IP-Lysis Buffer (10 mM Tris.Cl pH 8.0, 100 mM NaCl, 10% glycerol, 0.1% NP-40, and Roche cOmplete™ EDTA-free protease inhibitor cocktail) ...