Labshake search
Citations for Roche :
3601 - 3650 of 5547 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of each library was examined by a KAPA library quantification kit (KK4809, Kapa Biosystems), and then the quantified libraries were pooled at 10 nM ...
-
bioRxiv - Cell Biology 2024Quote: RNA extraction from cultured cells has been performed using the High Pure RNA Isolation Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: RNAs were extracted 48 hours after RNP transfection using the High Pure RNA Isolation Kit (Roche) according to instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... The pooled library was quantified using KAPA Library Quantification Kit (Kapa Biosystems, Cape Town, South Africa) diluted and denatured as the guideline of Illumina’s sequencing library preparation ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... RNA was used to generate cDNA libraries using a KAPA mRNA HyperPrep Kit (Roche, Basel, Switzerland) on a Hamilton Starlet robotic platform (Hamilton Company ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The four paired-end libraries were quantified by qPCR using the KAPA Library Quantification Kit (Roche). Genome sequencing was conducted on the Illumina MiSeq platform at the Federal University of Rio Grande do Sul ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA was extracted from 5-8 pairs of ovaries using an RNA extraction kit (Roche). 50 ng of total RNA was used to make cDNA using the Transcriptor First Strand cDNA Synthesis kit (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using FastStart SYBR Green Master kit (Roche, Indianapolis, IN).
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was purified from one million cells with the High Pure RNA Isolation kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Concentration of the pool was measured with quantitative PCR (KAPA Library Quantification Kit, Roche, Basel, Switzerland). Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina ...
-
bioRxiv - Pathology 2024Quote: ... and detection were performed using DIG High Prime DNA Labeling and Detection Starter Kit I (Roche) according to the instruction manual.
-
bioRxiv - Genetics 2024Quote: ... and PCR amplified using the KAPA HiFi Uracil PCR Kit (Catalogue Number: ROC-07959052001, Kapa Biosystems). The final libraries were assessed with the Agilent 2200 Tapestation System using D1000 Kit (Catalogue Number:5067-5582) ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified library was purified and then quantified using KAPA library quantification kit (#07960255001, Roche, Basel, Switzerland) and Bioanalyzer (Agilent technologies) ...
-
bioRxiv - Immunology 2023Quote: ... amplified complementary DNA was used to prepare libraries with KAPA HyperPrep Kit (Kapa Biosystems, cat. KK8504). Samples were barcoded and ran on NovaSeq6000 in a 100bp/100bp paired-end run.
-
bioRxiv - Zoology 2023Quote: ... RNA was reverse transcribed using a Transcriptor First Strand cDNA synthesis Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The brain slices were processed using the In Situ Cell Death Detection Kits (Roche Life Science) according to manufacturer’s instruction.
-
bioRxiv - Plant Biology 2023Quote: ... The purified PCR products were prepared for the libraries using the Kapa DNA Hyper Kit (Roche) utilizing indexes from TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Antisense RNA probes were synthesized using SP6 RNA polymerase and the DIG-labelling kit (Roche, #11277073910) as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using the Light Cycler 480 SYBR green I Master kit (Roche, Cat# 04887352001). The primers used for RT-qPCR are listed in the Key Resource Table ...
-
bioRxiv - Systems Biology 2024Quote: ... strand-specific RNA-seq library was built with the KAPA RNA Hyper Prep kit (Kapa Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... The qPCR analysis was performed using the KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems) and amplifications were carried out in the Step One Plus Real-Time PCR System (Applied biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were equimolarly pooled and subjected to qPCR quantification using the KAPA library quantification kit (Roche). Sequencing was carried out on the NovaSeq 6000 instrument from Illumina based on a 2*100 cycle mode (paired-end reads ...
-
bioRxiv - Plant Biology 2024Quote: CUT&RUN and greenCUT&RUN libraries were constructed using the KAPA HyperPrep Kit (Roche Holding AG), with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... PolyA enrichment and library preparation was performed using the KAPA mRNA HyperPrep Kit (Kapa Biosystems #8098115702) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequencing libraries were quantified by real-time PCR using KAPA Library Quantification Kit for NGS (Roche) and assessed for size distribution on a Fragment Analyzer (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... Probe preparation and subsequent DIG detection were conducted using the DIG Northern Starter Kit (Roche, 12039672910) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: 1000ng of DNA was used to prepare the library using the KAPA Target Enrichment Kit (Roche) for exome sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... full-length KILR was amplified from T47D cDNA using the KAPA HiFi PCR Kit (Kapa Biosystems) and KCTD1-5 cDNA was synthesized by IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by the detection with the ultraView Universal DAB Detection kit (Ventana Medical System Inc., Roche), according to the automated procedure ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from RNA using a KAPA Stranded RNA-Seq Library Preparation Kit (Roche NimbleGen). DNA/cDNA libraries with index adapters were then prepared using the KAPA Library Preparation Kit (Roche NimbleGen ...
-
bioRxiv - Pathology 2023Quote: ... The RNA-seq libraries were prepared with KAPA Stranded mRNA-Seq Illumina® Platforms Kit (Roche) following the manufactureŕs recommendations starting with 500 ng of total RNA as the input material ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the High Pure PCR Product Purification Kit (Roche Applied Science) [44].
-
bioRxiv - Cancer Biology 2023Quote: ... Secreted calcitonin was measured by electrochemical luminescence immunoassay (ECLIA) using an Elecsys Calcitonin kit (Roche, Germany). Secreted CEA was measured by chemiluminescent microparticle immunoassay (CMIA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV2 ITR specific probe was labeled using the DIG DNA labeling kit (11175033910, Roche, Switzerland) using the following oligonucleotide ...
-
bioRxiv - Plant Biology 2024Quote: ... Polymerase chain reactions (PCRs) were done employing the KAPA HiFi HotStart ReadyMix PCR Kit (#KK2601; Roche Sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was processed for reverse transcription (RT) using Transcriptor First Strand cDNA Synthesis Kit (Roche). Real-time PCR reactions were carried out using SYBRGreen Master Mix (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell-clone colonies were tested for β-galactosidase expression to check viral infectivity (kit Roche #11758241001). Positive clones were transduced with the lentiviral vector (LV ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified pool was quantified by real-time PCR with the Kapa Biosystems Quantification Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: DNA from liver and cell pellets was isolated using High Pure PCR Template Preparation Kit (Roche). DNA concentrations were measured by Nanodrop 2000c Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was conducted with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers used for qRT-PCR are listed in Supplementary Table 2 ...
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: ... Probe was generated using the PCR DIG probe synthesis reaction kit (Roche cat# 11636090910, Basel, Switzerland). Tel2 (GAATAATGAGAATTTTCAGGC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Messenger RNA library construction was performed using the Kapa HyperPrep mRNA Stranded with Riboerase kit (Roche). Each indexed sample was pooled in equimolar amounts and sequenced on two lanes of a NovaSeq4000 with paired end 150 bp reads at the UT Arlington North Texas Genome Center ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... and concentrations were determined using the Kapa SYBR FAST Universal qPCR kit for Illumina sequencing (Roche). Paired-end 75 cycle sequencing was completed using two Mid Output 150 cycle kits on the NextSeq 550 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... DNA fragmentation was evaluated using a Cellular DNA Fragmentation ELISA Kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: To detect DNA fragmentation in GFAP+ astrocytes an in situ cell death detection kit (Roche, 11684795910) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Sst sense and antisense probes were transcribed using a DIG or FITC RNA labeling kit (Roche) and purified with RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Neuroscience 2023Quote: RNA-Seq library was prepared using the KAPA Stranded RNA-Seq Kit with RiboErase (Kapa Biosystems) according to the manufacturer’s instructions ...