Labshake search
Citations for Roche :
301 - 350 of 1671 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... pellets were thawn and re-suspended in 400 μl of lysis buffer (50mM HEPES pH7.5, 150mM NaCl, 5mM MgCl2, 40mM N-Ethylmaleimide, EDTA-free protease inhibitor cocktail (Roche) and 2mM PMSF (Sigma) ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1020 ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were rinsed with buffer solutions and treated with an antidigoxigeninhorseradish peroxidase (HRP) conjugate (Roche Molecular Biochemicals) and a cyanin-5 substrate kit (CY5 ...
-
bioRxiv - Immunology 2024Quote: ... horseradish peroxidase (HRP) and bovine serum albumin fraction V (BSA) were from Roche (Merck, Burlington, MA, USA) and the Gαq inhibitor YM-254890 was from Wako Chemicals Europe (Neuss ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA ...
-
bioRxiv - Biophysics 2024Quote: ... Antibody-reaction with anti-DIG antibody (1:2000, Roche, MA) was performed at 4°C overnight ...
-
bioRxiv - Genomics 2024Quote: Each primary antibody was diluted in Antibody Diluent (Roche, 5266319001), incubated for 32 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were pre-washed in 0.25%BSA/DPBS and resuspended in 1ml of L3 sonication buffer (10mM TrisCl pH 8.0, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-Laroylsarcosine, filtered and with Roche Protease Inhibitor #04693159001) with 1% Triton ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and stressed (n=4) DA neurons to prepare stranded RNAseq libraries following manufacturer’s recommendations using KAPA mRNA hyperprep (Roche Diagnostic). Each final library was quantified and qualified with 2200 Tapestation (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 mg of fly heads from each genotype was homogenized in 2.9 ml of lysis buffer (8 M urea, 1% SDS, 1× PBS, 50 mM N-ethylmaleimide from Sigma, and a protease inhibitor cocktail from Roche). After the centrifugation of lysates at 16,000g at 4 ºC for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... sulfanilamide (Reagent I) and N-(1-Naphthyl)-Ethylenediamine in hydrochloric acid (Reagent II) from the “Nitrite/Nitrate Colorimetric Test” (Roche) kit (#11746081001 ...
-
bioRxiv - Cell Biology 2021Quote: ... was applied and was visualized with anti-rabbit HQ and anti-HQ-HRP followed by ChromoMap DAB (Roche). Prior to the incubation of the second primary ab ...
-
bioRxiv - Cell Biology 2021Quote: ... was applied and was visualized with anti-rabbit HQ and anti-HQ-HRP followed by ChromoMap DAB (Roche). Samples were counter stained with hematoxylin ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were cut and immunodetected with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche) or HRP-conjugated Flag M2 (1:2000 ...
-
bioRxiv - Plant Biology 2024Quote: ... The membranes were then probed with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche), HRP-conjugated FLAG M2 (1:5000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibody solution containing anti-DIG-POD antibody (1:250, Roche, RRID:AB_514500) and mouse anti-GFP antibody (1:500 ...
-
bioRxiv - Microbiology 2020Quote: Primary antibody dilutions were used as follows: rat α-HA antibody (Roche) 1:2,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibody: rat-derived monoclonal anti-HA antibody (dilution 1:250; Roche). Secondary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated overnight with primary antibody α HA antibodies (Roche 3F10) (1:1000 dilution in 20% blocking solution I ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with anti-TLR7 antibody and anti-HA antibody (Roche) at 37 °C for 90 min ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: monoclonal anti GFP antibody (1:500; Roche), monoclonal anti HA antibody (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA (50 μg) was separated on 1% agarose–formaldehyde gels and transferred to Hybond-N+ nylon membranes (Roche, Basel, Switzerland). Northern blotting was conducted with biotin-labeled DNA (bio-CTGTAGAAAGTCTGCTGATCGATACCGCGACG ...
-
bioRxiv - Microbiology 2024Quote: ... BHK cells were transfected with 3 μg of pBAC-SARS-COV-2 construct and1 μg of SARS-CoV-2 N (Delta) plasmid with the X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... N-glycans were released directly using cartilage lysates following deglycosylation by overnight treatment with peptide N-glycanase F (PNGase F, 2U) (Roche, Switzerland). The supernatants containing GSLs and fOSs were dried with a centrifugal evaporator ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue was incubated with the probe overnight and Arc positive cells were detected with anti-digoxigenin-HRP conjugate (Roche Applied Science Ref # ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with horseradish peroxidase (HRP)-conjugated anti-DIG (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fab fragment antibody (Roche) solution in blocking buffer at room temperature for 2 hours with no blocking step ...
-
bioRxiv - Biophysics 2020Quote: ... Anti-Dig antibodies (Roche). Buffer solutions ...
-
bioRxiv - Biophysics 2021Quote: ... digoxigenin antibodies (Roche Diagnostics) at a concentration of 0.1 mg/ml in PBS buffer were incubated for ~1 hour within the flow cell ...
-
bioRxiv - Cell Biology 2021Quote: ... His6 antibodies from Roche (11922416001 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fab fragment antibody (Roche) at 1:3000 dilution and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Myc (11814150001) antibodies (Roche); phosphorylated IκBα (AF5851) ...
-
bioRxiv - Plant Biology 2023Quote: ... antibodies (1:2000, Roche). The ACTIN loading control was detected using anti-ACTIN C4 mouse antibody (1:500 ...