Labshake search
Citations for Roche :
201 - 250 of 1671 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... α-HA-horseradish peroxidase (HRP) (3F10, Roche, Basel, Switzerland), 1:5,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or anti-mouse horseradish peroxidase (HRP) (760–4313, Roche) secondary antibodies and the Discovery ChromoMap DAB kit reagents (760–159 ...
-
bioRxiv - Plant Biology 2024Quote: ... HRP conjugated primary anti-HA (clone 3F10, 12013819001, Roche) or anti-FLAG (M2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and HRP-conjugated anti-HA (Roche, #12013819001, RRID: AB_390917). Secondary antibodies used in this work include HRP-conjugated anti-rabbit IgG (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2022Quote: ... synthesized by IDT) with 66 mM digoxigenin N-hydroxysuccinimide ester (Roche) in 50 mM HEPES-NaOH ...
-
bioRxiv - Biochemistry 2020Quote: ... N-glycans were released with 2.5 U PNGase F (Roche, Australia) for 16 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1% N-Lauroylsarcosine supplemented with 1mM PMSF and protease inhibitors (Roche)) at the concentration of 4×107 cells/ml ...
-
bioRxiv - Biophysics 2024Quote: ... Hen egg white lysozyme was purchased from Roche (Cat. N° 10837059001) or from Seikagaku Corp ...
-
bioRxiv - Cancer Biology 2020Quote: ... The q-RT-PCR experiments were conducted using SYBR Green and a Lightcycler96 (Roche, Indianapolis, USA).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-HA (HRP-conjugated, 12013819001, Roche, 1:3000 dilution).
-
bioRxiv - Molecular Biology 2021Quote: ... plates were washed and incubated with streptavidin-HRP conjugate (Roche) for 30 mins ...
-
bioRxiv - Cell Biology 2021Quote: ... rat monoclonal anti-HA-HRP (Roche, 12 013 819 001), mouse monoclonal anti-beta-Actin-HRP (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... was applied and visualized with anti-mouse OmniMap-HRP (Roche) and detected with Discovery Purple (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... and/or anti-FITC-HRP (Roche/Sigma 11426346910, 1:2000) for 15-17 hours in TNTx (Tris-HCl pH 8.0 - Invitrogen 15567-027 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 mM N-ethylmaleimide) with 1x Complete EDTA-free protease inhibitors (Roche) and 6 μl benzonase (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... DUB inhibitor (10 mM N-ethylmaleimide) and phosphatase inhibitor (PhosphoStop, Roche, USA) using a POLYTRON hand homogenizer(19) ...
-
bioRxiv - Genetics 2020Quote: ... acid-extracted histones were digested with Asp-N and Arg-C (Roche) and the resulting digests were analyzed by chromatography on an Ultimate 3000 nanoLC (Dionex ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.5% n-octyl-β-D-glucopyranoside) supplemented with protease inhibitors (Roche), and ultrasonicated for protein extraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (Q-PCR) reactions were performed using LightCycler FastStart DNA MasterPlus SYBR Green I kit (Roche). For each primer set ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Cancer Biology 2022Quote: Immunoprecipitated chromatin has been analysed by q-PCR using the LightCycler 480 SYBR Green I Master (Roche) on a LightCycler® 96 Instrument or the Mesa Green qPCR MasterMix Plus for SYBR Assay (Eurogentec ...
-
bioRxiv - Neuroscience 2020Quote: ... Arc-positive cells were detected with anti– digoxigenin-HRP conjugate (Roche Applied Science Ref # ...
-
bioRxiv - Neuroscience 2021Quote: ... HRP-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and TSA-plus Cyanine 3 (1:70 in 1× plus amplification diluent ...
-
bioRxiv - Microbiology 2021Quote: ... Discovery OmniMap anti-Rabbit HRP (Roche Tissue Diagnostics cat# 760-4311), and Discovery OmniMap anti-mouse HRP (Roche Tissue Diagnostics cat# 760-4310) ...
-
bioRxiv - Immunology 2020Quote: ... The OmniMap anti rabbit HRP kit (760-4311, Roche Diagnostics, UK) was used to detect the antibodies of interest ...
-
bioRxiv - Plant Biology 2022Quote: ... The immunoblots were detected by anti-HA-HRP (Roche, Code:12013819001) and anti-Myc-Tag (9B11 ...
-
bioRxiv - Pathology 2023Quote: ... The expressed proteins were detected by using anti-HA-HRP (Roche) at a dilution of 1:5,000 ...
-
bioRxiv - Microbiology 2024Quote: ... 1:1,000 rat anti-HA Horseradish Peroxidase (HRP) conjugated (Roche 12013819001), 1:1,000 rabbit anti-caspase 8 (Cell Signaling Technology 4927) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptide N-glycosidase F (PNGase F, lyophilized, glycerol-free) was purchased from Roche Diagnostics (Mannheim ...
-
bioRxiv - Physiology 2022Quote: ... containing protease inhibitors (protease inhibitor cocktails tablets, catalog n° 48047900, Roche, Basel, Switzerland). After high-speed shaking in TissueLyserII (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... N-glycans were released by incubation with 1.0 mU PNGase A (Roche Diagnostics) in 60 μL 0.5 M citrate/phosphate buffer at pH 4.0 for 16 h and purified using a Carbograph Ultra Clean column (Alltech ...
-
bioRxiv - Immunology 2023Quote: ... 20 mM N-ethylmaleimide) supplemented with cOmplete Mini EDTA-free protease inhibitors (Roche), and centrifuged at 20,000 x g for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: The In Situ Cell Death Detection Kit Fluorescein (Roche, N°11684-795-910) was used for detecting dying cells in intact Hv_Basel ...
-
bioRxiv - Biophysics 2023Quote: ... solubilized with 1 % final concentration n-Dodecyl β-D-maltoside (Roche, Mannheim, Germany) and incubated for 5 min at 25 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Q-PCR was conducted to detect RNA amounts using FastStart Universal SYBR Green Master (ROX; Roche, Basel, Switzerland) with StepOne Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... Quantitative real-time PCR analysis (q-PCR) was performed with FastStart Universal SYBR Green Master (Roche, Shanghai, China) on a Bio-Rad instrument ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were immunologically detected by using anti-HA (3F10)-HRP (Roche, Switzerland) or anti-Myc-tag (HRP-DirecT ...
-
bioRxiv - Systems Biology 2020Quote: ... HAx3-Ptp2 was detected using an anti-HA HRP conjugate 3F10 (Roche) at a 1:5,000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... and Discovery OmniMap anti-mouse HRP (Roche Tissue Diagnostics cat# 760-4310). Slides were mounted using ProLong Diamond Antifade mountant w/ DAPI (Invitrogen cat# P36971).
-
bioRxiv - Physiology 2020Quote: ... Probes were detected with HRP anti-Dig Fab (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Plant Biology 2024Quote: ... Immunoblotting was performed using rat HRP-conjugated α-HA (monoclonal 3F10, Roche) and subsequently chemiluminescent substrate SuperSignal™ West Pico PLUS (Thermo Scientific™) ...
-
bioRxiv - Microbiology 2022Quote: ... the semi-nested real-time q-PCR reactions (LightCycler 480 II, Roche Life Science, Roche Diagnostics Corporation, IN, USA) were performed with 1:5-diluted 1st PCR product ...
-
bioRxiv - Genomics 2020Quote: ... or the KAPA Library Quantification Kit (scRNA-seq libraries only; Roche, Cat. N: 07960298001). Size distribution of the obtained libraries was assessed using Agilent 2100 Bioanalyzer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% N-Lauroylsarcosine) and resuspended in 100 μl complete LB3 (LB3 containing 1x Roche cOmplete Mini ...
-
bioRxiv - Microbiology 2020Quote: ... and precB5R-N+GPC by using X-tremeGENE 9 (Roche Diagnostics K.K., Tokyo, Japan). Cells transfected with each plasmid were then infected with m8 at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Physiology 2024Quote: ... Blocking was performed using a blocking solution (western blocking reagent Roche catalog N°11921673001) containing 0.15% Triton X-100 and 1% BSA in 300 mM Glycine for 1 hour at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... KASPar genotyping assays were carried out with a single end-point measure on a Q-PCR Light Cycler 480 (Roche) using the Agencourt® DNAdvance kit (Beckman) ...
-
bioRxiv - Physiology 2024Quote: ... and real time quantitative PCR (Q-PCR) was conducted using Power SYBR Green detection reagent (Thermo Fischer Scientific) on a Light Cycler 480 II (Roche).
-
bioRxiv - Bioengineering 2024Quote: ... 8-16 hCOs were lysed in 300 μl of 1% SDS in Milli-Q water with cOmplete ULTRA Protease Inhibitor Cocktail (Roche). Samples were vortexed ...