Labshake search
Citations for Roche :
301 - 350 of 7219 citations for 7 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.15% NP40, 1 x Complete protease inhibitors, Roche) and rotated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with the primers listed in the section above ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...
-
bioRxiv - Microbiology 2019Quote: ... cells were harvested at 0 to 7 DPI in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extracted from the parasites at passages 7 and 20 were digested with 5 U Rsa1 (Roche) at 37 °C overnight ...
-
bioRxiv - Physiology 2024Quote: ... from two bees were pooled and homogenized in 250 µL of phosphate-buffered saline (7 mM NaCl, 2.7 mM KCl, and 10 mM PO4, pH 7.4) containing cOmplete protease inhibitors (Roche) at kept on ice until further processing ...
-
bioRxiv - Genetics 2019Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with a protease-inhibitor cocktail (Roche). Cells were subsequently incubated on ice for 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche), as described previously (Kemaladewi et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 mM Tris(2-carboxyethyl)phosphine (TCEP) and cOmplete protease inhibitors (Roche). Cells were lysed by sonication and cell debris pelleted at 25,000 rpm for 40 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM Mg(OAc)2 supplemented with phosphatase and protease inhibitors (Roche) (adapted from (29)) ...
-
bioRxiv - Biophysics 2021Quote: ... Suspended membrane vesicles were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Immunology 2021Quote: ... slices were blocked for 30 min (2% BSA, 0.1ug/ul Salmon Sperm, 0.5% Saponin, 1 U/µl protector RNase inhibitor (Roche) in 3X SSC ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche] ...
-
bioRxiv - Neuroscience 2021Quote: ... The floating sections were then treated with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml, 10236276001; Roche Diagnostics) at room temperature for 20 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM MOPS, pH 7.2; 2 mM EDTA; 1 mM PMSF; 1X cØmplete, mini, EDTA-free protease inhibitor cocktail, Roche). Cells were lysed by bead beating with 0.5 mm glass beads for 3×20s at 6.5 m/s in a benchtop homogenizer (Fastprep-24 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM MOPS, pH 7.2; 2 mM EDTA; 1 mM PMSF; 1X cØmplete, mini, EDTA-free protease inhibitor cocktail, Roche). Cells were lysed by bead beating with 0.5 mm glass beads for 3×20s at 6.5 m/s in a benchtop homogenizer (Fastprep-24 ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 M PIPES-NaOH pH 6.9, 2 mM EGTA, 1 mM MgSO4, 0.1 mM EDTA, cOmplete protease inhibitors [Roche]) (5 min ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1 × protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 μl/10 mg) ...