Labshake search
Citations for Roche :
201 - 250 of 7219 citations for 7 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... and then resuspended in lysis buffer (10 mM Hepes-NaOH, 100 mM NaCl, 2 mM EDTA, 1 mM EGTA, 1 mM PMSF, 0.2% SDS, 0.1% sarkozyl, Roche proteases inhibitor). Sonication was performed with a Misonix sonicator (fifteen cycles of 20 seconds sonication interspaced by a pause of 50 seconds) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were extracted from adherent cells by scraping into extraction buffer (1× LysisM, 1× protease inhibitor cocktail, 2 x phosphatase inhibitor cocktail (all Roche), 2 mM sodium orthovanadate (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... with buffer II with protease inhibitors (8 μg/ml Aprotinin, 10 μg/ml Leupeptin, 1 μg/ml Pepstatin, 1 mM PMSF and 2 tablets cOmplete Mini, EDTA free; Roche) and 2 times flash frozen in liquid Nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Developmental Biology 2023Quote: ... sections were washed three times with TBST and then incubated with appropriate secondary antibodies (2 µg/mL in TBST / 1% bovine serum albumin (BSA)) and 1 µg/mL DAPI (Roche) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated tissue was cut in pieces of 2 cm and digested for 1h at 37°C in a HBSS solution containing 1% P/S and 2 U ml-1 Dispase II (Roche). Epidermal layer was separated from the dermis using two tweezers ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were co-transfected with sgRNA expression vectors and lentiviral packaging constructs psPAX2 and pMD2.G (VSV-G) in a 2:1:1 ratio using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Cell Biology 2019Quote: ... 125 mM NaCl, 1% NP-40, 2 mM EDTA, 1 mM PMSF [Sigma, 93482-50ML-F], and protease inhibitor cocktail [Roche, 000000011836170001) and incubated on ice for 25 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM NaCl, 2 mM MgCl2, 10 mM NaF, 1 mM PMSF, 1% Triton X-100 and Complete Protease inhibitor mixture, Roche Diagnostics) for 45 min on ice and centrifuged at 20000g for 10 min at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... diluted 2-fold with PBMC culture media and supplemented with 10% WST-1 reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM PMSF) supplemented with 1 protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Developmental Biology 2023Quote: ... was diluted 1 in 50 in solution consisting of 2 % blocking reagent (Roche ref 11096176001), 1 % goat serum (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Roche). To reduce autofluorescence ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Physiology 2021Quote: ... 1:500 goat anti-rabbit (AlexaFlour 488; A-11008) and 1:1000 4′,6-diamidino-2-phenylindole (DAPI; Roche 10236276001; Basel, Switzerland). After secondary incubations ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...