Labshake search
Citations for Roche :
301 - 350 of 2968 citations for 5 Bromo 2 3 dihydro 1H indole hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Developmental Biology 2023Quote: ... with probe prepared by nick translation of a double-stranded PCR product bearing the bcd ORF using alkali-stable digoxigenin-11-2’-deoxyuridine-5’-triphosphate (Roche), visualizing with alkaline-phosphate coupled sheep anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Plant Biology 2019Quote: ... Total proteins from 120 seedlings were extracted with 150 µL of extraction buffer (50 mM Tris-HCl pH 7.4, 80 mM NaCl, 0.1 % Tween 20, 10 % glycerol, 10 mM dithiothreitol, 2× Protease inhibitor cocktail [11873580001, Roche], 5 mM PMSF). Prior to protein quantification ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 cycles of primary PCR to amplify the region of interest was performed using 2 μL of DNeasy eluate (∼100–300 ng template) in a 5 μL Kapa HiFi HotStart polymerase reaction (Kapa Biosystems; for primers see Supplementary Data Set 1) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.5% Triton X-100, 100 mM NaF, 1 mM ortho-vanadate, 2 mM EDTA, and a protease inhibitor cocktail [Roche 11836153001]). Lysates were vortexed and cleared by centrifugation (15,000 x g for 15 min at 4°C) ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... All the signals were visualized by adding 3-3′-Diaaminobenzidinetetrahydrochloride (DAB substrate) solution (Roche) to the slides and counterstained with haematoxylin ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol in MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 300 mM MgAc ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Biophysics 2021Quote: ... Cell pellets were resuspended in Lysis Buffer (25 mM HEPES pH 8.0, 250 mM NaCl, 10 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol, 10% glycerol and supplemented with Roche cOmplete protease inhibitor) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... autofluorescence was quenched by treating paraffin-embedded sections with PBS/BSA (5%) for 2 h before performing TUNEL staining (Roche, Basel, Switzerland) according to the manufacturer’s protocol and using Proteinase K treatment ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...