Labshake search
Citations for Roche :
251 - 300 of 2968 citations for 5 Bromo 2 3 dihydro 1H indole hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL / well of MTT (3- [4,5-dimethylthiazol-2-yl] −0,5-diphenyl tetrazolium bromide (11465007001; Roche Life Science, Mannheim, Germany) labeling reagent (1× ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Molecular Biology 2019Quote: ... and viability was measured using the Roche MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) kit (Roche, Cat # 11465007001) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... The beads were then collected at 1000 g for 2 min and washed at least 3 times with lysis buffer coupled with protease inhibitor cocktail (Roche). After last wash and centrifugation ...
-
bioRxiv - Molecular Biology 2023Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μl diluted cDNA (5 ng total RNA equivalents) were analyzed on the LightCycler 480 instrument (Roche) using two replicates ...
-
bioRxiv - Biophysics 2022Quote: ... 200 mM NaCl, 5 mM Beta glycerophosphate, 0.1 mM sodium orthovanadate, 2 mM TCEP, 0.4% NP40, 1X Roche EDTA free mini complete protease inhibitor) ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were lysed in LUMIER lysis buffer (50 mM Hepes-KOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 5% glycerol and Roche cOmplete™ Mini protease Inhibitor Cocktail ...
-
bioRxiv - Immunology 2022Quote: ... these tissues were dissected and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... and the resulting duplex was captured on 3 mg streptavidin-coated magnetic beads (Roche, rotation for 2 h at 37°C). After extraction with phenol-chloroform and precipitation with ethanol ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol, Roche Complete Protease Inhibitors and PhosSTOP Protein Phosphatase Inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Immunology 2022Quote: ... These tissues were cut to ∼2mm pieces and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Cell Biology 2019Quote: ... and resuspended in Laemmli sample buffer (2% SDS, 5% β 50 mM Tris-Cl pH 6.8) supplemented with Protease Inhibitor Cocktail and PhosStop (Roche) for isolation of total cellular protein ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were lysed in lysis buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 10% glycerol, 2 mM DTT, 30 mM imidazole and complete EDTA-free protease inhibitors cocktail [Roche]) supplemented with 1 mM TCEP ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...