Labshake search
Citations for Roche :
301 - 350 of 2527 citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ng ds-cDNA was processed for library construction using KAPA Hyper Prep Kit (Kapa Biosystems #KK8504) according to the standard protocol except that a 15-min USER enzyme (BioLab # M5505L ...
-
bioRxiv - Systems Biology 2023Quote: ... 3 mM MgCl2 and 0.1% IGEPAL CA-630) supplemented with 0.2U/µl of RNAse Protector (Roche, Switzerland), was added to each sample ...
-
bioRxiv - Genomics 2023Quote: Mastermix 3 (IS-PCR) was freshly prepared and contained 12.5 μl Kapa HiFi Hotstart Readymix (2x, Roche), 0.25 μl IS PCR Primers (10 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were homogenized 3 x 30s at 7000 power in a MagnaLyzer® (Roche Diagnostics, Basel, Schweiz) and placed on ice for ∼1 minute between each homogenization ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM NaCl, 3 mM MgCl2, 0.5 mM spermidine, 0.2 mM spermine, 0.01% Triton-X, 1x Roche complete protease inhibitors ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 3 hours with Anti-Digoxigenin-AP Fab fragments (dilution 1:3000) (Roche, 11093274910) at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Bioengineering 2022Quote: A total of 3 µL of AAV was treated with 20 units of DNase I (Roche #04716728001) at 37°C for 45 min to remove residual DNA in vector samples ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25Msucrose, 3 mM MgCI2, 0.2% NP-40, 3mM p-mercaptoethanol, 0.4mMPMSF, Complete protease inhibitor tablets from Roche). Chromatin fragmentation was performed by MNase treatment in ChlP SDS lysis buffer (50mMHEPES ...
-
bioRxiv - Bioengineering 2024Quote: A total of 3 µL of AAV was treated with 20 units of DNase I (Roche #04716728001) at 37°C for 45 min to remove residual DNA in vector samples ...
-
bioRxiv - Cell Biology 2024Quote: ... The beads were washed 3 times using 1X MAPK Lysis Buffer with 1X protease inhibitors (Complete, Roche). The bound proteins were then eluted by boiling at 70°C for 10 minutes in 1×SDS loading buffer prior to SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T cells or 0.75 million primary neurons using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in 10 μM BrdU:BrdC (3:1) for 16–20 h before incubation with 0.1 μg/mL colcemid (Roche) for 2-3 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissected hippocampi were dissolved in lysis buffer (1M Tris-Cl, pH 7.5; 6M NaCl; 10% SDS; 0.5M EDTA; Triton-X 100; Phosphatase Inhibitor #3, Roche, #05-892-970-001 ...
-
bioRxiv - Biophysics 2020Quote: ... The 3′ end of the 1,882-nt DNA handle was labeled with dig-ddUTP using terminal transferase (Roche), and the 798-nt DNA handle of the transcript was functionalized with biotin on the 5′ end of the PCR primer ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were harvested and lysed in IP buffer (1 x PBS, 3 mM KCl, 2.5 mM MgCl2, 0,5 % Triton X-100 and protease inhibitors from Roche). 35 μl of this lysate was loaded onto an SDS-gel (lysate lanes) ...
-
bioRxiv - Cell Biology 2022Quote: ... The sonicated sample was layered over 3 ml of S3 solution (0.88 M sucrose, 0.5 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) in a new Falcon tube and centrifuged at 3000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The resuspended pellet was layered carefully over 3 ml of S2 solution (0.35 M sucrose, 0.5 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) and centrifuged at 1430 × g for 5 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... 5 µL of 20 mM siRNAs and 3 µL of X-tremeGENE HP DNA Transfection Reagent (Roche, #6366546001) were diluted in 200 µL Opti-MEM (Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... Positive control embryos were incubated in polymerase chain reaction buffer containing 3 U/ml DNase I recombinant (Roche) for 1 h at 37°C before adding the TUNEL reaction mix ...
-
bioRxiv - Microbiology 2022Quote: ... purified GST-RomA was incubated with equal amounts of HIS6-LphD or HIS6-LphD Y392F in protein binding buffer (25 mM Tris pH 8.0, 140 mM NaCl, 3 mM KCl, 0.1% NP40 with protease inhibitors (ROCHE)) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... The 2nd strand was synthesized using 2nd primer (5-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGTATCAACGCAGAGTAC -3) with KAPA HiFi HS mix (KAPA Biosystems). The double stranded cDNAs were amplified using Illumina adapter-specific primers and LongAmp Taq DNA polymerase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...