Labshake search
Citations for Roche :
451 - 500 of 2527 citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... The antisense RNA probes corresponding to the 3’ s-end portion of glnA CDS were prepared by the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... derived from SlARF2A and SlARF2B promoter was labeled with digoxigenin as per the manufacturer’s protocol using DIG Oligonucleotide 3′-End Labeling Kit (Roche Diagnostics). The same unlabeled DNA fragment was used as a competitor ...
-
bioRxiv - Plant Biology 2022Quote: ... derived from SlGLYI4 promoter was labelled with digoxigenin as per the manufacturer’s protocol using DIG Oligonucleotide 3′- End Labelling Kit (Roche Diagnostics). The same unlabelled DNA fragment was used as a competitor ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MRTX849 for 3 hours prior to protein isolation with RIPA buffer containing 1x cOmpleted EDTA free protease inhibitor (Roche) and 1x phosSTOP (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... Each cDNA sample was measured in duplicate using 3 μL of 4x diluted cDNA per 10 μL reaction in a LightCycler96 Instrument (Roche). qPCR parameters were set to 10 minutes of preincubation at 95 °C ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were isolated by carefully transferring the extracted parasite mixture on top of a 0.25 M to 0.1 M sucrose gradient in cell lysis buffer (10 mM Tris pH 8, 3 mM MgCl2, 0.2% NP-40, 1x EDTA free Protease inhibitor (Roche, 04693132001); 15 mL 0.25 M Sucrose and 17.5 mL 0.1M Sucrose for 50 mL tubes ...
-
bioRxiv - Developmental Biology 2024Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was then subjected to further purification by precipitation with 3 volumes of KAPA Pure Beads according to manufacturer’s instructions (KAPA Biosystems). The assessment of RNA integrity number (RIN ...
-
bioRxiv - Immunology 2024Quote: Single-cell suspensions of the tumors were obtained by incubating minced tissues with 3 mg/mL collagenase A (Roche, Germany) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Immunology 2024Quote: Single-cell suspensions of the tumors were obtained by incubating minced tissues with 3 mg/mL collagenase A (Roche, Germany) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were harvested in PBS with protease inhibitors (1mM PMSF, Phosphatase Inhibitor Cocktail 3 [Sigma-Aldrich, P004] and Complete [Roche]) and centrifuged for 3 min at 500g at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Next the beads were washed 3 times with 800 µl of wash buffer (TBS + 0.1% Tween, EDTA-free Protease Inhibitor Cocktail (Roche, 04693132001)) ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Biochemistry 2024Quote: ... Telomere ends were hybridized with Cy3-OO-(TTAGGG)3 in hybridization solution (70% formamide, 1 mg/ml blocking reagent (1109617601, Roche), and 10 mM Tris-HCl pH 7.2 ...
-
bioRxiv - Bioengineering 2024Quote: ... lung tissue was minced and incubated in 3 mL of serum-free media containing 0.5 mg/mL DNase I (Roche, 10104159001) and 1 mg/mL collagenase type IV (Worthington ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... Lung tissues were cut into small pieces and then digested in RPMI1640 containing 3 mg/mL of collagenase A (Roche) and 0.15 mg/mL of DNase I (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA probes were generated via PCR amplification from 3 dpf cDNA fused to T7 promoter sequence and subsequently transcribed (DIG or FITC labeled) using T7 polymerase (Roche). Primer sequences can be found in supplemental table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... at 4°C for 1 hour with end-over-end rotation and washed 3 times with 1X MAPK Lysis Buffer with 1X protease inhibitor (Complete, Roche). Worm lysates prepared from the above were then equally divided into tubes containing glutathione beads coated with respective proteins for 2 hours incubation at 4°C with end-over-end rotation ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... After homogenizing the tissue in ice-cold PBS with protease inhibitors (1mM PMSF; Phosphatase Inhibitor Cocktail 3, Sigma-Aldrich; Complete, Roche), the extracts were crosslinked with 1% formaldehyde for 10 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... cells at 40% confluency were transfected with 1 µg of mammalian expression plasmid DNA containing gene of interest using 3 µL X-tremeGENE 9 DNA transfection reagent (Roche, 6365809001) diluted in 100 µL 1x OPTI-MEM I reduced serum medium (Gibco ...
-
bioRxiv - Systems Biology 2024Quote: ... (after a 3-hour fasting period) was measured by taking blood from the tail tip using an Accu-Chek glucometer (Roche Diagnostics). Mice then received an intraperitoneal (ip ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were lysed in 50 μl of Lysis Buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1x Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DIG-labeled 3’UTR of Emi2 and cyclin B1 RNA probes were synthesized with a DIG-RNA-labeling kit (Roche Molecular Biochemicals). Two μg of probes was incubated with purified Flag-tagged proteins for 15 min ...