Labshake search
Citations for Roche :
301 - 350 of 7402 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM PMSF and 2 tablets cOmplete protease inhibitor (Roche #5056489001) per 50 mL of lysate ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and 2 × Complete protease inhibitor (Roche, Indianapolis, IN) on ice for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were lysed using Lysis buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 3 mM TCEP and 1 tablet Roche Protease inhibitor per 10 mL of buffer). Lysate was clarified by centrifugation at 24,000 g for 40 mins at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... monocytes were harvested using ice-cold lysis buffer (1% Triton X-100, 2% SDS, 150 mM NaCl, 10 mM HEPES, 2 mM EDTA containing protease inhibitor cocktail - Roche). Cell lysates were heated at 100 °C for 5 min in the presence of Laemmli buffer (20% β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 20 mM KCl, 2 mM MgCl2, 1% TX-100, 40U Ribolock ml-2 and protease inhibitor cocktail, Roche) followed by clearing at 17 000 × g for 10 min at +4C° ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 M urea, 0.5% SDS, 1 mM EDTA pH8.0, 1 mM DTT, and 1× protease inhibitor cocktail [Roche, cat#4693132001]). Biotinylated RBPs were captured by affinity purification ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... pH 7.5) with the addition of 2 mg·ml-1 collagenase (Roche, Indianapolis). Defolliculated oocytes were injected with ENaC cRNAs into the cytosol (25 ng per oocyte in 50 nl of RNase-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... nuclei were stained with 4,6 diamine-2-phenylindole (1:25000, DAPI, Roche) in PBS 1X for 1 minute ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM Tris(2-carboxyethyl)phosphine (TCEP) and complete protease inhibitor (Roche)) and added to the oligo-bound magnetic beads for 2 hours at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche], 2 U/mL DNase I [Life Technologies] and Dispase II [Roche]). The digested brain parenchyma ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...