Labshake search
Citations for Roche :
251 - 300 of 7402 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Cell Biology 2024Quote: ... diluted in PBS containing 3% Bovine Serum Albumin (BSA; Roche Diagnostics, Basel, Switzerland), were applied onto the coverslips and incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 20min on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM β-mercaptoethanol in presence of Dnase 1 (Roche), EDTA-free protease inhibitor coctail (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM benzamidine) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Microbiology 2023Quote: ... 1% P/S and 50 U/mL IL-2 (Roche), at 37°C and 5% CO2.
-
bioRxiv - Bioengineering 2023Quote: ... Collagenase B solution 2 mg ml−1 B (Roche, Indiana) was used for HUVEC isolation (detailed protocol in 10) ...
-
bioRxiv - Cell Biology 2021Quote: ... 350 mM NaCl, 2 mM MgOAc, 1 mM CaCl2, 15% glycerol, 0.1% Triton X-100, 0.05% 2-ME, 1x Roche protease inhibitors ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... was diluted 10-fold with ChIP incubation buffer (70 mM NaCl, 10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 2 mM EDTA, 0.1% Triton, 1 x Roche Complete EDTA-free Protease inhibitor cocktail) ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Physiology 2024Quote: ... and 5- nitro blue tetrazolium/bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Roche) as chromogenic substrates ...
-
bioRxiv - Immunology 2024Quote: ... lungs harvested in HEPES buffer containing Liberase Blendzyme 3 (70 μg/mL; Roche, #05401020001) and DNaseI (30 μg/ml ...
-
bioRxiv - Microbiology 2022Quote: Fresh pre-cut pancreatic tissue (2 × 2 mm) were digested with a solution of collagenase P in HBSS-1% HEPES (0.75 mg/mL, Roche) at 37°C for 7 min with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... in 100μl extraction buffer (Tris-HCl 50 mM pH 6.8, SDS 2%, DTT 2 mM and 1× protease inhibitors (Roche) and centrifuged for 5 min at 13,000g at 4OC ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... or with 1:10 Dnase I (stock 2 U/μL, Roche), and micrococcal nuclease (stock 2000 U/μL ...
-
bioRxiv - Immunology 2022Quote: ... 2 ml of DMEM with 0.26 U ml−1 LiberaseTM (Roche) and 0.25 mg ml−1 DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche). The cells were then lysed by sonication and cell debris was removed by centrifugation at 30,000 g for 45 min at 4° C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche) and lysed with an EmulsiFlex-C3 homogenizer at pressures above 20,000 psi ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI) (Roche, #10236276001, 1:500) with coverslips.