Labshake search
Citations for Roche :
301 - 350 of 3580 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl, 4 mM MgCl2, 2 mM DTT, 1% SDS, 0.5% sodium deoxycholate, 0.5% Igepal, supplemented with Roche Complete Protease Inhibitor cocktail (1 tablet/50 mL)) ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Neuroscience 2022Quote: ... The beads were then collected at 1000 g for 2 min and washed at least 3 times with lysis buffer coupled with protease inhibitor cocktail (Roche). After last wash and centrifugation ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg) of HIV-1 NL4-3 full-length replication competent plasmid using X-tremeGENE HP (Roche Applied Science) transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Biophysics 2024Quote: ... 150 mM NaCl and 2 mM CaCl2 (“Na + Ca”) were incubated at 37° C with Proteinase K (3 μg/ml) (Roche). Aliquots are removed at different time intervals following addition of the protease (0 ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% NP40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1mM Na3VO4, 4 μg/ml leupeptin, one Roche cOmplete™ protease inhibitor tablet ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: SDGC-SEC-purified stress granule cores (strain JD1370) were incubated at 0.23 A260 units/mL with 2 or 4 units of RNase H (10786357001; Roche) in 40 μL of RNase H buffer (20 mM HEPES-KOH pH 8.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μl diluted cDNA (5 ng total RNA equivalents) were analyzed on the LightCycler 480 instrument (Roche) using two replicates ...
-
bioRxiv - Cancer Biology 2023Quote: Proliferation was measured by using 5-bromo-2’-deoxy-uridine (BrdU) labelling and detection kit (Roche, BSL, CH) as described earlier (25) ...
-
bioRxiv - Biophysics 2022Quote: ... 200 mM NaCl, 5 mM Beta glycerophosphate, 0.1 mM sodium orthovanadate, 2 mM TCEP, 0.4% NP40, 1X Roche EDTA free mini complete protease inhibitor) ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were lysed in LUMIER lysis buffer (50 mM Hepes-KOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 5% glycerol and Roche cOmplete™ Mini protease Inhibitor Cocktail ...
-
bioRxiv - Physiology 2024Quote: ... 5 mM EDTA, 2% Triton-X-100, 0.2 mM HDSF, pH 7.4, and protease inhibitor cocktail from Roche). Following sonication on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1% deoxycholic acid and protease inhibitors (Roche), and thrice with lysis buffer without detergent ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.5% fatty acid-free BSA (Roche), 10 mg ml-1 Collagenase D (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subject to anti-GFP immunoprecipitation using GFP-Trap beads or anti-Myc immunoprecipitation using Myc-Trap beads (ChromoTek) ...
-
bioRxiv - Plant Biology 2023Quote: ... ethylenediaminetetraacetic acid free protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...