Labshake search
Citations for Roche :
451 - 500 of 3580 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 mg DNAse (Roche) and 4 mM MgCl2 was added and incubated for another hour ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 mM ascorbic acid) containing a protease inhibitor cocktail (Roche). All subsequent steps were conducted on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail cOmplete (Roche). For blocking and antibody dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... Okadaic acid (200nM) and a protease inhibitor cocktail (Roche Complete) with a Dounce homogenizer and solubilized for 1 hour rotating at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 0.25% sodium deoxycholic acid and complete protease inhibitor cocktail (Roche), pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Neuroscience 2024Quote: ... 3% SDC and PhosSTOP™ (Roche) by sonication at 40% amplitude for 4x10 sec ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Detection was accomplished using the DIG Nucleic Acid Detection Kit (Roche). Images were quantified using ImageJ ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4×PIC (Roche; Cat#05056489001)) was added to the pellets ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 mM ATP (Roche, 10519979001)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Version 4 (Roche, Mannheim, Germany), using MagNa Lyser Green Beads (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM PMSF (Roche), 10% glycerol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...