Labshake search
Citations for Roche :
3401 - 3450 of 10000+ citations for Rat Insulin Like Growth Factor 1 Receptor IGF1R ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The pool was quantified by qPCR using the KAPA Library Quantification Kit (Roche) then sequenced on the Illumina NextSeq500 sequencer using the 75nt high-output flow cell ...
-
bioRxiv - Developmental Biology 2021Quote: ... To detect cell death the “In Situ Cell Death AP kit” (Roche, #11684809910) was used ...
-
bioRxiv - Neuroscience 2021Quote: ... alkaline phosphatase activity was detected using an HNPP fluorescence detection kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ATP was determined using ATP Bioluminescence Assay Kit HS II (Roche, Mannheim, Germany) according to manufacturer’s instructions with some modifications ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed using a Transcriptor first-strand cDNA synthesis kit (Roche) using random hexamers as primers (25°C for10 min ...
-
bioRxiv - Immunology 2020Quote: ... ATP bioluminescense assay kit HS-II and Protease inhibitor cocktail was from Roche. Flou-4AM was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... DNA sequencing libraries were prepared using the PCR-free KAPA HyperPrep Kit (Roche). Libraries were sequenced on an Illumina NextSeq 500 and the quality of the raw sequencing reads was analysed with FastQC (version 0.11.4 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using the High Pure Viral RNA Kit (Roche, Basel, Switzerland). Partial RdRp was amplified using the SuperScript III OneStep RT-PCR and Platinum Taq Enzyme kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was harvested using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland). Two independent samples were analyzed ...
-
bioRxiv - Immunology 2020Quote: ... total RNA was converted into sequencing libraries using mRNA HyperPrep kit (KAPA/Roche) and custom Illumina-compatible unique dual index (UDI ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using the Roche Transcriptor First Strand Kit (04896866001, Roche). qPCR was carried out using cDNA diluted 1:7 ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche, (07962193001). Libraries were quantified using a KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo) ...
-
bioRxiv - Genetics 2020Quote: ... Library generation was performed using the KAPA Hyper Prep Kit (KK8504, Kapa Biosystems). After amplification and quantification ...
-
bioRxiv - Immunology 2021Quote: ... The following qRT-PCR was performed using a RealTime Ready PCR Kit (Roche) and Taqman primer-primer-probe mixes ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-seq library was constructed by KAPA mRNA Hyper Prep Kit (KAPA BIOSYSTEMS) and SeqCap Adapter Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by qPCR using a Kapa Library Quantification Kit (Kapa Biosystems, KK4835).
-
bioRxiv - Cancer Biology 2020Quote: ... then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems). Libraries were submitted to PE75 sequencing on Illumina NextSeq500 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA extraction was performed manually using the High Pure RNA isolation kit (Roche) with an on-column DNase treatment according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-seq libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The shotgun sequencing library was constructed using the KAPA Hyper Prep Kit (Roche). Libraries were sequenced on the DNBSEQ-G400 (BGI ...
-
bioRxiv - Neuroscience 2022Quote: TUNEL staining was performed using the in-situ cell death detection kit (Roche) in sagittal paraffin sections of 4μm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared by using the KAPA HyperPrep kit (Roche, Basel, Switzerland, # 7962363001) according to the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed using the FastStart Essential DNA Green Master kit (Roche, 06924204001) on LightCycler® 96 instrument (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted using the High Pure RNA isolation kit (Roche Molecular Systems) according to manufacturer’s instructions and following the general precautions required for RNA work (39) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA fragments were prepared with the KAPA HTP Library Preparation Kit (Roche) for sequencing ...
-
bioRxiv - Genomics 2022Quote: ... and libraries prepared using the KAPA Hyper Prep kit for DNA (Roche KK8504). Truncated universal stub adapters were ligated to DNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... We measured ATP concentration with the “ATP bioluminescence assay kit HS II” (Roche) according to the manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was synthesized with Transcriptor First Strand cDNA synthesis kit (Roche, Basel, Switzerland). qPCR experiments were performed using QuantStudio 5 Real-time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: The In Situ Cell Death Detection Kit Fluorescein (Roche, N°11684-795-910) was used for detecting dying cells in intact Hv_Basel ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation was done with the KAPA DNA or RNA Hyperprep kit (Roche). Ligation was made with Illumina dual-index UMI (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (2.5nM) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (0.23nM) ...
-
bioRxiv - Genomics 2022Quote: ... Linear NGS library construction was performed using a KAPA HyperPrep library kit (Roche) according to published protocols ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... constructed barcoded libraries for sequencing using KAPA HyperPrep kits (Roche Sequencing, Pleasanton, CA) with a target fragment size of 500 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed using a commercially available kit provided by KAPA Biosystems (KAPA Hyper Prep with Library Amplification Primer Mix ...
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LDH release levels were analyzed using a Cytotoxicity Detection Kit (Roche, Basel, Switzerland). Purified Ply(1μM)was co-cultured with various concentrations of alnustone at 37°C for 30min ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... JE1 amylase activities were measured in culture supernatants using the AMYL kit (Roche/Hitachi #11876473 001 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated by using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart SYBR green master mix (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.