Labshake search
Citations for Roche :
3201 - 3250 of 8093 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto a flowcell ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on a flowcell ...
-
bioRxiv - Cancer Biology 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on flowcell lanes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.50 μl 10x PCR reaction buffer including 15 mM MgCl2 (Roche); 1.50 μl dNTPs mix (250 μM each dNTP) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The membrane was then incubated in antibody detection solution consisting of 1:20000 anti-HA rat mAb conjugated to horseradish peroxidase (HRP) (Roche [3F10], Cat. # 1201381900) diluted in MTBST 0.05% for 1 hour at room temperature on a tube rotator ...
-
bioRxiv - Microbiology 2024Quote: Nucleic acids wash and immunological detection of the DIG-labeled probes were performed using the DIG Wash and Block Buffer Set (Roche, Cat No. 11585762001) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2022Quote: ... All Mediator knock-out lines were verified as homozygous for the appropriate T-DNA insertion and transcript levels were quantified by RT-qPCR using a Roche 454 (Roche, Clifton NJ, USA) as described previously (Crawford et al. ...
-
bioRxiv - Immunology 2024Quote: ... Brains were homogenized using a glass Potter and digested for 45 min at room temperature (RT) in Hanks’ balanced salt solution (HBSS) medium with collagenase D (1 mg/ml, Roche Diagnostics cat # 11088882001) and deoxyribonuclease (DNase ...
-
bioRxiv - Synthetic Biology 2019Quote: ... rinsed three times with the same buffer and then soaked in BM chemiluminescence blotting substrate (Roche Molecular Diagnostics). After 1 min of incubation in the dark ...
-
bioRxiv - Neuroscience 2019Quote: Retina sections were washed three times then permeabilized in PBS with 0.3% Triton-X 100 (PBST; Roche, Switzerland) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: Doubling times were calculated using two different methods: (i) Impedance measurements were assessed using the RTCA system (Roche) by seeding at different cell densities and registering impedance signals every 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... were washed three times with Wash Buffer (20 mM HEPES-KOH pH 7.5, 150 mM NaCl, 0.5 mM spermidine, Roche complete Protease Inhibitor tablet EDTA free ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were then washed four times with PBS and signal was developed by adding POD substrate (11484281001, Roche) for 5 minutes before stopping with 1 M H2SO4 ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were then washed four times with PBS and signal was developed by adding POD substrate (11484281001, Roche) before stopping with 1 M H2SO4 after 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... emitted fluorescence was measured three times during the annealing-extension phase using the LightCycler 96 System (Roche, Basel). Amplification plots were analyzed using the LightCycler 96 System Application Software (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500,000 trypsinized ESC were washed a total of three times with Wash Buffer (20 mM HEPES-KOH pH 7.5, 150 mM NaCl, 0.5 mM spermidine, Roche complete Protease Inhibitor tablet EDTA free ...
-
bioRxiv - Physiology 2019Quote: ... Blood glucose values were measured afterwards at specified time points using an Accu-Chek Aviva system (Roche, Switzerland).
-
bioRxiv - Neuroscience 2022Quote: Brain sections were washed three times then permeabilized in TBS with 0.2% Triton-X 100 (TBST; Roche, Switzerland) at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were washed three times (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Immunology 2023Quote: ... Detection of antibody binding was visualized by chemiluminescence using the ECLplus Western blotting detection system (catalog no. RPN2132; Amersham Bioscience, Little Chalfont, United Kingdom) and Lumi-Film (catalog no. 11666657001, Roche Applied Science, Mannheim, Germany).
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR reactions were performed using the LightCycler® 480 SYBR Green I Master Mix with a LightCycler 480 instrument (Roche Applied Science, UK) under the following conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... Primer efficiencies were evaluated by RT-qPCR using LightCycler® 480 SYBR Green I Master and LightCycler® 480 instrument II (Roche, Bâle, Switzerland). Gene expression was quantified using the Biomark microfluidic system ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was performed using the AMPLIQON 2x qPCR Master Mix Green-No ROX using a LightCycler® 96 System (Roche Life Science, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed on a Lightcycler 480 II (Roche, Penzberg, Germany) using the following TaqMan probes ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed on the LightCycler 480 System (Roche, Basel, Switzerland) using Kapa SYBR Fast Universal Kit (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR reactions were performed using the Universal Probe Library system (Roche) and a SensiFast Probe kit (Bioline) ...
-
bioRxiv - Immunology 2021Quote: ... The qRT-PCR was performed on LightCycler® 480 (Roche, Basel, Schweiz) using AbsQuant 2nd Derivative Max for obtaining the Ct value ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using 0.6X-1.2X KAPA Pure Beads (Roche, KK8000) and then further amplified using P5_seq_eGFP_F2 and P7_Ind_#_Han primers for 7 PCR cycles to add P5 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were cooled to 55°C and PCR grade Proteinase K (Roche) was added to a concentration of 1 ug/ul ...
-
bioRxiv - Genetics 2021Quote: ... and qRT-PCR reactions were run with the SYBR Green reagent (Roche) using Lightcycler 480 (Roche) ...
-
bioRxiv - Developmental Biology 2021Quote: Quantitative PCR experiments were performed using SYBR Green Technology (Roche, Applied Biosystem) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The quantitative PCR reactions were conducted on Light Cycler 96 (Roche, Switzerland).
-
bioRxiv - Bioengineering 2022Quote: ... and analyzed by quantitative PCR on a LightCycler 480 II instrument (Roche) using a 2-step protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... quantitative PCR was performed on a LightCycler 480 Multiwell Plate 96 (Roche). For amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... eluted and PCR-amplified with KAPA 2X HiFi HotStart ReadyMix (Kapa Biosystems) and the NEBNext Multiplex Oligos for Illumina® (Dual Index Primers Set 1) ...
-
bioRxiv - Molecular Biology 2020Quote: PCR products were transferred to a positively charged nylon membrane (Roche, Switzerland) using capillary transfer under denaturing conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR (qPCR) was performed on a LightCycler 480 (Roche, Basel, Switzerland) using miRNA LNA technology and Pick&Mix PCR pre-designed panels (Exiqon ...
-
bioRxiv - Microbiology 2019Quote: ... Probes were generated using the PCR DIG labelling Mix (Roche, Mannheim, Germany) according to the manufacturer’s instructions (Table S1).
-
bioRxiv - Microbiology 2019Quote: Quantitative PCR was performed using a LightCycler® 480 (Roche, Hertfordshire, UK). For primer sequences see Table 2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction contained 0.5 μl of KAPA HiFi polymerase (KAPA Biosystems), 0.75 μl dNTPs (10 mM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction contained 0.5 μl of KAPA HiFi polymerase (KAPA Biosystems), 0.75 μl dNTPs (10 mM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science), followed by the real-time PCR analysis using LightCycler96 (Roche Applied Science) ...
-
bioRxiv - Genomics 2019Quote: ... Quantitative PCR was performed on cDNA using a LightCycler 480 System (Roche), and a standard curve of 8-80m molecules of the 5,340-bp plasmid pETnT was used to estimate absolute transcript levels.
-
bioRxiv - Evolutionary Biology 2019Quote: ... The PCR cycle conditions followed were as per the manufacturer’s protocol (Roche). PCR product was outsourced for purification and sequencing to Amnion Biosciences Pvt ...
-
bioRxiv - Genomics 2021Quote: ... 11 PCR cycles and KAPA Taq HotStart DNA polymerase (Kapa Biosystems, # KK1512).
-
bioRxiv - Genomics 2021Quote: ... 11 PCR cycles and KAPA Taq HotStart DNA polymerase (Kapa Biosystems, # KK1512). MNase-seq read count correlation of four independent replicates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Cancer Biology 2019Quote: ... qRT–PCR was performed using FastStart Universal SYBR Green Master mix (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... qRT-PCR was performed with a LightCycler® Nano (Roche Diagnostic K.K.) using 40 cycles of a three-stage program with the following conditions ...