Labshake search
Citations for Roche :
3101 - 3150 of 8038 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Standard PCR reactions were performed using KAPATaq DNA polymerase (Kapa Biosystems). PCR products used for cloning ...
-
bioRxiv - Genetics 2023Quote: ... and lncRNA AC069262.1 using qRT-PCR LightCycler 480 Instrument II (Roche) using specific primers and iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2023Quote: ... and the Kapa HiFi Uracil+ PCR system (cat#: KK2801, Kapa Biosystems) with the following cycling parameters ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). DNA libraries were multiplexed and loaded on an Illumina MiSeq instrument according to manufacturer’s instructions (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto a flowcell ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on four flow cell lanes ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed using KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland) and a MiniAmpPlus thermal cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a flowcell ...
-
bioRxiv - Developmental Biology 2023Quote: ... qRT-PCR reactions were run in a LightCycler 480 Instrument (Roche) using a 5 μl reaction mixture of DNA SYBR Green I Master (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR was performed on a 480 Light Cycler thermocycler (Roche) using the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on one lane of a flowcell ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was carried out in a LightCycler 480 instrument (Roche) with specific primers (Table 2 ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified by PCR with KAPA HiFi HotStart Ready Mix (Roche). PCR conditions consisted of 15 min at 37°C followed by 12 cycles of 98°C for 30 sec ...
-
bioRxiv - Neuroscience 2023Quote: ... The qRT-PCR was done with SYBR Green I Master (Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification was conducted using KAPA HiFi HotStart ReadyMix (Roche) and amplicons were analyzed by gel electrophoresis followed by sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR measurements were carried out on a Lightcycler 480 (Roche) using Lightcycler 480 multiwell plates (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). Reads were aligned against National Center for Biotechnology Information Build 37 (hg19 ...
-
bioRxiv - Cell Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on one flowcell lane ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... PCR was amplified with KAPA HiFi HotStart DNA Polymerase (Roche, Switzerland) using genomic DNA of A ...
-
bioRxiv - Genetics 2024Quote: ... The sequencing library was generated using two Kappa PCR reactions (Roche) with primers detailed in table 4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... template switching reaction and PCR pre-amplification (KAPA HiFi HotStart (Roche), 18 cycles ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quantitative PCR (qPCR) was performed on a LightCycler 480 System (Roche) using LightCycler 480 SYBR Green I Master Mix reagents (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Genetics 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The libraries were multiplexed and clustered onto two flowcells and were loaded onto an Illumina HiSeq 4000 instrument ...
-
bioRxiv - Cell Biology 2024Quote: ... qRT-PCR was performed on a Light Cycler 480 instrument (Roche). Each PCR reaction contained 0.6 µM of the primers specific to the genes of interest ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto a flowcell ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on a flowcell ...
-
bioRxiv - Cancer Biology 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on flowcell lanes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.50 μl 10x PCR reaction buffer including 15 mM MgCl2 (Roche); 1.50 μl dNTPs mix (250 μM each dNTP) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The membrane was then incubated in antibody detection solution consisting of 1:20000 anti-HA rat mAb conjugated to horseradish peroxidase (HRP) (Roche [3F10], Cat. # 1201381900) diluted in MTBST 0.05% for 1 hour at room temperature on a tube rotator ...
-
bioRxiv - Microbiology 2024Quote: Nucleic acids wash and immunological detection of the DIG-labeled probes were performed using the DIG Wash and Block Buffer Set (Roche, Cat No. 11585762001) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2022Quote: ... All Mediator knock-out lines were verified as homozygous for the appropriate T-DNA insertion and transcript levels were quantified by RT-qPCR using a Roche 454 (Roche, Clifton NJ, USA) as described previously (Crawford et al. ...
-
bioRxiv - Immunology 2024Quote: ... Brains were homogenized using a glass Potter and digested for 45 min at room temperature (RT) in Hanks’ balanced salt solution (HBSS) medium with collagenase D (1 mg/ml, Roche Diagnostics cat # 11088882001) and deoxyribonuclease (DNase ...
-
bioRxiv - Synthetic Biology 2019Quote: ... rinsed three times with the same buffer and then soaked in BM chemiluminescence blotting substrate (Roche Molecular Diagnostics). After 1 min of incubation in the dark ...
-
bioRxiv - Neuroscience 2019Quote: Retina sections were washed three times then permeabilized in PBS with 0.3% Triton-X 100 (PBST; Roche, Switzerland) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: Doubling times were calculated using two different methods: (i) Impedance measurements were assessed using the RTCA system (Roche) by seeding at different cell densities and registering impedance signals every 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... were washed three times with Wash Buffer (20 mM HEPES-KOH pH 7.5, 150 mM NaCl, 0.5 mM spermidine, Roche complete Protease Inhibitor tablet EDTA free ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were then washed four times with PBS and signal was developed by adding POD substrate (11484281001, Roche) for 5 minutes before stopping with 1 M H2SO4 ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were then washed four times with PBS and signal was developed by adding POD substrate (11484281001, Roche) before stopping with 1 M H2SO4 after 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... emitted fluorescence was measured three times during the annealing-extension phase using the LightCycler 96 System (Roche, Basel). Amplification plots were analyzed using the LightCycler 96 System Application Software (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500,000 trypsinized ESC were washed a total of three times with Wash Buffer (20 mM HEPES-KOH pH 7.5, 150 mM NaCl, 0.5 mM spermidine, Roche complete Protease Inhibitor tablet EDTA free ...
-
bioRxiv - Physiology 2019Quote: ... Blood glucose values were measured afterwards at specified time points using an Accu-Chek Aviva system (Roche, Switzerland).
-
bioRxiv - Neuroscience 2022Quote: Brain sections were washed three times then permeabilized in TBS with 0.2% Triton-X 100 (TBST; Roche, Switzerland) at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were washed three times (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Immunology 2023Quote: ... Detection of antibody binding was visualized by chemiluminescence using the ECLplus Western blotting detection system (catalog no. RPN2132; Amersham Bioscience, Little Chalfont, United Kingdom) and Lumi-Film (catalog no. 11666657001, Roche Applied Science, Mannheim, Germany).
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR reactions were performed using the LightCycler® 480 SYBR Green I Master Mix with a LightCycler 480 instrument (Roche Applied Science, UK) under the following conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... Primer efficiencies were evaluated by RT-qPCR using LightCycler® 480 SYBR Green I Master and LightCycler® 480 instrument II (Roche, Bâle, Switzerland). Gene expression was quantified using the Biomark microfluidic system ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...