Labshake search
Citations for Roche :
251 - 300 of 8093 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... on the LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). ORF 1ab was amplified from cDNA and cloned into MS2-nCoV-ORF1ab and used as the plasmid standard after its identity was confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 μL KAPA HiFi Real Time PCR master mix (KAPA Biosystems) and 9 μL size selected DNA solutions in a total reaction volume of 20 μL ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative PCR was performed with the Applied BiosystemsTM PowerUP™ SYBR™ Green Master Mix from Applied Biosystems on a real-time PCR instrument (LightCycler® 480 System, Roche) using the primers listed in Supplementary Table 2.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and run on a LightCycler 480 real-time PCR instrument (Roche). The quantified libraries were prepared for sequencing utilizing a TruSeq paired-end cluster kit (v3) ...
-
bioRxiv - Plant Biology 2021Quote: ... in a LightCycler 480 Real-Time PCR System (Roche, Basal, Switzerland). Expression levels were normalized by ACTIN2 (ACT2) ...
-
bioRxiv - Cell Biology 2021Quote: ... using LightCycler ® 96 Real-Time PCR System (Roche Life Science). The specificity of the primers was verified with a single peak in the melt curve ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was carried out on LightCycler®480 (Roche) using SYBR-green ...
-
bioRxiv - Molecular Biology 2021Quote: Quantitative real time PCR was performed using SYBR green chemistry (Roche) with specific set of primer pairs (Supp Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was performed on a LightCycler480 system (Roche) using SYBR Green Master Mix (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time PCR was performed by using Roche LightCycler96 (Roche, 05815916001) system and SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR was performed with SYBR Green I (Roche) using a CFX96 Touch Real-Time PCR Detection System (BIORAD) ...
-
bioRxiv - Genetics 2022Quote: ... on a LightCycler 480 Real-Time PCR System (Roche, Applied Science).2 µL (3 ng ...
-
bioRxiv - Microbiology 2024Quote: ... and run on a LightCycler 480 real-time PCR instrument (Roche). The quantified libraries were then multiplexed and the pool of libraries was then prepared for sequencing on the Illumina NovaSeq 6000 sequencing platform using NovaSeq XP v1 reagent kits (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time quantitative PCR was performed on a LightCycler 480 (Roche), and the relative fold change in gene expression was measured with the 2-ΔΔCT method.
-
bioRxiv - Genomics 2023Quote: ... in a LightCycler 96 Real-Time PCR System (Roche Applied Science). All reactions were performed in triplicates ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the LightCycler® 480 Real-Time PCR (Roche Life Science) system ...
-
bioRxiv - Neuroscience 2023Quote: ... The Light Cycler® 480 Real-Time PCR System (Roche, Germany) was used to perform qPCR.
-
bioRxiv - Genomics 2023Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Molecular Biology 2023Quote: ... and performed using the LightCycler 480 Real-Time PCR Instrument (Roche). The amplification protocol was performed as follows ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were quantitated using real-time PCR (Kapa Biosystems, Wilmington, MA). Libraries were pooled and Single read ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time PCR (qPCR) was performed using the KAPA SYBR FAST Universal qPCR Kit (KAPA BIOSYSTEMS) in a QuantStudio3 system (Life Technology) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by quantitative real-time PCR on cDNA using the FastStart Essential DNA Green Master kit (Roche) and the LightCycler® Nano (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was performed with a LightCycler® 480 SYBR Green I Master Mix kit (Roche). The primers used in the indicated gene array are listed in Table S1 ...
-
bioRxiv - Microbiology 2019Quote: Real-time PCR amplifications were carried out using LightCycler® 480 Probes Master kit (Roche diagnostics, France) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by real time quantitative PCR using Kapa SYBR Fast qPCR kit (Kapa Biosystems, Catalog No. KR0389_S) and Light Cycler 96 (Roche) ...
-
bioRxiv - Pathology 2020Quote: ... cDNA templates were used for real-time quantitative PCR with KAPA SYBR Fast qPCR kit (KAPA Biosystems) and analyzed with the Roche LightCycler 480 ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR (qPCR) reactions were performed using the KAPA SYBR Fast qPCR Kit (Kapa Biosystems; KK4601), with gene-specific primers in technical triplicates and in biological triplicates (Neuro2a cells) ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR assays were performed using the LightCycler FastStart DNA Master PLUS SYBR Green kit (Roche) and a LightCycler PCR instrument (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time PCRs were carried out with the Fast Start Essential DNA Green Master kit (06402712001, Roche) and Bio-Rad CFX96 real-time PCR system ...
-
bioRxiv - Neuroscience 2019Quote: ... Genotyping of the OXTR SNPs was performed by real-time polymerase chain reaction (PCR) and subsequent melting curve detection using a Cobas Z 480 Light Cycler (Roche Diagnostics, Mannheim, Germany). With the melting curve analyses ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was performed on LightCycler® 480 (Roche, Basel, Schweiz) using AbsQuant 2nd Derivative Max for obtaining the Ct value ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed with the LightCycler 480 Real-Time SYBR Green PCR System (Roche), used primers are listed in (Supplemental Dataset 5) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR experiments were performed in a Light-Cycler480 Real-Time SYBRgreen PCR system (Roche). 500 ng of RNA was reverse-transcribed with the qScript® cDNA Supermix kit (QuantaBio ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using FastStart Universal SYBR Green Master (Roche) and the StepOnePlus thermocycler (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was performed on a LightCycler® 480 (Roche Diagnostics). Assays were made in triplicates and results normalized according to the expression levels of TBP ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR was performed with the LightCycler 480 Real-Time SYBR Green PCR System (Roche), used primers are listed in Table S2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed on a Light-Cycler 480 real-time PCR machine (Roche, Switzerland) by using PrimeScript™ RT reagent (Perfect Real Time ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative real-time PCR was performed on a LightCycler 480 II PCR system (Roche, Switzerland) with SYBR Green qPCR Master Mix (TaKaRa Bio) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell proliferation was measured using Real-time Excelligence system (RT-CES, F Hoffman La-Roche) measured every hour ...
-
bioRxiv - Genomics 2019Quote: ... and KAPA Real Time Library Amplification Kit (KAPA Biosystems) at Institute for Genomic Medicine at University of California ...
-
bioRxiv - Genomics 2024Quote: ... and KAPA Real Time Library Amplification Kit (KAPA Biosystems) following manufacturers manual ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA extracts were tested by RT-PCR using the Titan One Tube RT-PCR kit (Roche) and the primers of Li et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell lysates were prepared as described previously [17] Quantitative detection of mRNA was performed by real-time PCR using the Lightcycler 480 detector (Roche Applied Science, Manheim Germany) as previously published [17].
-
bioRxiv - Developmental Biology 2021Quote: ... Real-Time PCR was performed using FastStart SYBR Green Master (Roche Scientific) in a LightCycler 480 system II (Roche Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real time PCR was performed using a LightCycler 480 system (Roche) with the LightCycler 480 SybrGreen I Master mix ...
-
bioRxiv - Microbiology 2022Quote: ... the semi-nested real-time q-PCR reactions (LightCycler 480 II, Roche Life Science ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR amplifications were performed in a LightCycler480 system (Roche Diagnostics) in 384-well plates on 5 μL scale reactions using 2 μL diluted cDNAs and Brilliant III Ultra-fast SYBR Green qPCR Master Mix (Agilent ...
-
bioRxiv - Microbiology 2019Quote: Real-time quantitative PCR was done on a LightCycler 480 (Roche Diagnostics) using the SensiFast SYBR-NoRox kit (Bioline ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative real-time PCRs were performed in the LightCycler 480 Instrument (Roche), using RealTime 2xPCRMaster Mix SYBR (A&A Biotechnology ...