Labshake search
Citations for Roche :
151 - 200 of 8093 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was carried out using SYBR Green PCR mix (Roche) in Roche LightCycler 480II Instrument.
-
bioRxiv - Immunology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with SYBR green (Roche) in a StepOnePlus system (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2023Quote: ... Real-time PCR was conducted using the SYBR green PCR reagent (Roche) and StepOnePlus™ System (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: PCR was conducted using the LightCycler 480 Real-Time PCR System (Roche). The cycling program began with a denaturation step of 95°C for 10 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... Real-time PCR was performed using LightCycler© 480 real-time system as per manufacturer’s protocol (Roche, Germany).
-
bioRxiv - Evolutionary Biology 2022Quote: ... real-time PCR for gapdh and prickle1 was conducted with KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) and Applied Biosystems 7300 Real time PCR system ...
-
bioRxiv - Pathology 2021Quote: ... Real time PCR was performed with a LightCycler 480 SYBR Green I master quantitative PCR kit (Roche Diagnostics) according to the manufacturer’s protocol ...
-
bioRxiv - Epidemiology 2021Quote: ... Resulting cDNA was used for quantitative real-time PCR (qPCR) analysis with a SYBR Green PCR kit (Roche). β-Actin was used as reference gene ...
-
bioRxiv - Immunology 2021Quote: ... Ct values for Asns and the housekeeping gene Actb (Beta-actin) were determined by quantitative real-time PCR on a LightCycler® 480 II Real-Time PCR System (Roche Life Science), using the TB Green™ Premix Ex Taq™ (Takara ...
-
bioRxiv - Developmental Biology 2020Quote: ... kit according to the manufacturer’s instructions on a LightCycler 96 Real-Time PCR System (Roche).
-
bioRxiv - Cancer Biology 2019Quote: Libraries were quantified by real-time PCR using the Kapa library quantification kit (Kapa Biosystems) on a Roche LightCycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed with the KAPA SYBR FAST qPCR kit (KAPA Biosystems, USA) on a LightCycler 480 instrument (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Both PCR amplifications were done with KAPA Real-time library Amp kit (Roche, Wilmington, MA) with a cycle condition ...
-
bioRxiv - Plant Biology 2024Quote: ... Real-time quantitative PCR assays were prepared using KAPA SYBR FAST qPCR kit (Kapa Biosystems) and run on an Applied Biosystems QuantStudio 12K QPCR instrument ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time quantitative PCR assays were prepared using KAPA SYBR FAST qPCR kit (Kapa Biosystems) and run on an Applied Biosystems QuantStudio 12K QPCR instrument ...
-
bioRxiv - Cancer Biology 2024Quote: ... and quantified using real time PCR with an NGS Library Quantification Kit (Roche/Kapa Biosystems) on a StepOnePlus Real Time PCR Workstation (Thermo/ABI) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and quantified using real time PCR with an NGS Library Quantification Kit (Roche/Kapa Biosystems) on a StepOnePlus Real Time PCR Workstation (Thermo/ABI).
-
bioRxiv - Cancer Biology 2024Quote: ... and quantified using real time PCR with an NGS Library Quantification Kit (Roche/Kapa Biosystems) on a StepOnePlus Real Time PCR Workstation (Thermo/ABI) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and quantified using real time PCR with an NGS Library Quantification Kit (Roche/Kapa Biosystems) on a StepOnePlus Real Time PCR Workstation (Thermo/ABI).
-
bioRxiv - Cancer Biology 2021Quote: The thermal stability assay was performed in the Real Time Detection system (Roche). Each pMHC complex was diluted in 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2020Quote: Some LAMP-OSD reactions were analyzed in real-time using LightCycler 96 real-time PCR machine (Roche, Basel, Switzerland). Reactions were subjected to 30 cycles of two-step incubations – step 1:150 sec at 65 °C ...
-
bioRxiv - Immunology 2022Quote: ... and SYBR RT-PCR kit (Roche) were used for qRT-PCR analysis by using gene-specific primers (S1 Table) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Plant Biology 2020Quote: ... and 6.8 μL ddH2O were used and the RT-qPCR was performed using a Light Cycler 96 Real-Time PCR Machine (Roche, Germany). Expression levels were calculated using the 2-ΔCT equation (Kilambi et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Quantification of viral RNA was performed using a real-time RT-PCR assay specific for HTNV nucleocapsid coding region in a LightCycler® 96 (Roche) following manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... PCR reactions were run on a LightCycler 480 Real-Time PCR System (Roche) according to the following conditions ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... PCRs were run in a LightCycler 96® Real-time PCR system (Roche). Transcript levels relative to HPRT1 were calculated using the ΔCt method.
-
Local induction of IAA5 and IAA29 promotes DNA damage-triggered stem cell death in Arabidopsis rootsbioRxiv - Plant Biology 2022Quote: ... PCR reactions were conducted with the LightCycler 480 Real-Time PCR system (ROCHE) under the following conditions ...
-
Local induction of IAA5 and IAA29 promotes DNA damage-triggered stem cell death in Arabidopsis rootsbioRxiv - Plant Biology 2022Quote: ... PCR reactions were conducted with the LightCycler 480 Real-Time PCR system (ROCHE) under the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and real-time PCR was performed (LightCycler96, Roche, Basel, CHE) with SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time PCR was performed by Light Cycler 96 (Roche Health Care Thermalcycler 96 ...
-
bioRxiv - Plant Biology 2019Quote: ... in a Light Cycler 96 Real-Time PCR instrument (Roche). For semi-quantitative RT-PCR assays ...
-
bioRxiv - Genomics 2019Quote: ... in a Light Cycler 96 Real Time PCR system (Roche). Briefly ...
-
bioRxiv - Plant Biology 2020Quote: ... the LightCycler 480 Real-Time SYBR Green PCR System (Roche) was used ...
-
bioRxiv - Cell Biology 2021Quote: ... and a LightCycler® II real-time PCR system (Roche). Dissociation curve analysis of the amplified DNA melting temperature showed that each primer set gave a single and specific product (Sun et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... on a Lightcycler 480 Real-Time PCR system (Roche Diagnostics). Relative quantification of expression was calculated after data analysis by the Lightcycler 480 software (Roche Diagnostics) ...
-
bioRxiv - Neuroscience 2022Quote: ... on the LightCycler ® 96 Real-Time PCR System (Roche). Final primer concentration was 0.5 µM and probe concentration was 0.1 µM ...
-
bioRxiv - Physiology 2019Quote: ... a LightCycler 480 Real-Time PCR system (Roche, Mannheim, Germany), with SYBR Green (Roche ...
-
bioRxiv - Physiology 2019Quote: ... using a LightCycler480 Real-Time PCR system (Roche, Basel, Switzerland). All data were normalized to the expression of 36B4 ...
-
bioRxiv - Physiology 2021Quote: Real-time PCR was performed using a LightCycler480 (Roche, Switzerland). Reverse transcription products were diluted to 1/30 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed (Roche LightCycler® 480 II) using a prime time gene expression master mix (IDT ...
-
bioRxiv - Immunology 2021Quote: ... with a LightCycler® 480 Real-Time PCR System (Roche). Gene expression was then assessed with the BioMark HD (Fluidigm ...
-
bioRxiv - Physiology 2022Quote: ... using LightCycler® 96 Real-Time PCR System (Roche, USA). The primer sequences were obtained from Takara and listed in supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a real-time PCR instrument LightCycler (Roche, Ltd., Germany) as previously reported 17 ...
-
bioRxiv - Neuroscience 2024Quote: ... on a Light Cycler Real-Time PCR System (480II, Roche). The primer sequences (Shanghai Generay Biotech Co. ...
-
bioRxiv - Plant Biology 2024Quote: ... and a Lightcycler 480 Real-Time PCR system (Roche Diagnostics), according to the supplier’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Real-time PCR was run in a Lightcycler 480 (Roche), using SYBR Green Master Mix–BioRad as a fluorescent dye ...
-
bioRxiv - Genomics 2023Quote: ... Real-time quantitative PCR was done with SYBR green (Roche) according to the manual with the primer sets for each gene as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... using the LightCycler 480 II real-time PCR device (Roche). Each reaction volume was 10 µL and reactions were run in quadruplicate ...
-
bioRxiv - Bioengineering 2023Quote: ... and a LightCycler® 480 Real-time PCR System (Roche) according to the manufacturers’ protocols ...