Labshake search
Citations for Roche :
251 - 300 of 3505 citations for Transcription Factor SOX 10 SOX10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 10% glycerol) with protease (Roche) and phosphatase (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 10% glycerol) with protease (Roche) and phosphatase (Roche ...
-
bioRxiv - Immunology 2019Quote: ... 10 μg/ml DNaseI (Roche) and 1 mg/ml Dispase (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μg/μl leupeptin (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... 10 µg/µl leupeptin (Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl of Glycogene (Roche) was used per sample.
-
bioRxiv - Biochemistry 2021Quote: ... Leupeptin (10 μg/μL) (Roche), PMSF (1mM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5μl dNTP 10 mM (Roche), 6.8 μL dH2O,0.2μL Taq Polymerase (Roche),1 μL of each primer sequence which were added to thermocycler under the conditions of initial denaturation at 95 °C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 mg DNaseI (Roche) and incubated for 30 min on ice ...
-
bioRxiv - Immunology 2022Quote: ... 10% (v/v) Ethanol (Roche) and 2% (w/v ...
-
bioRxiv - Physiology 2022Quote: ... 10 µg/ml leupeptin (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM DTT (Roche Diagnostics)) and 0.1 mg/mL bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 mM dNTP mix (Roche), 5 μM forward and reverse primers (Metabion AG) ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μL DNAse I (Roche) 10 mg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 U/ml pronase (Roche) solution was added ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM DTT (Roche, 10708984001) was added to the samples ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 ng.ml-1 insulin (Roche) and cultured on Collagen I (BD Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 mM BrdU (Roche, Germany) was added to the culture medium ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 mg DNaseI (Roche) and incubated for 30 min on ice ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... 10 µg/ml insulin (Roche), 0.5 µg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 10% DNAse (Roche, #11284932001) for 45 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated from 1.0 μg of RNA using TaqMan Reverse Transcription (RT) Reagents and random hexamer primers (Roche, cat#N8080234). Equal volumes of cDNA were used for quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative reverse transcription PCR was performed using Eppendorf Realplex2 Mastercycler with reaction mixtures prepared with KAPA SYBR Fast Universal qPCR Kit (KAPA Biosystems). The PCR primers for KIF1A ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting PCR products were purified and used as templates for in vitro transcription by employing DIG RNA Labeling Kit (SP6/T7) (Roche #11175025910). The resulting RNAs generated from SP6-mediated in vitro transcription were used as positive probes (cRNA ...
-
bioRxiv - Plant Biology 2021Quote: ... The purified PCR product was then used for an in vitro transcription reaction using the DIG RNA Labeling Mix (#11175025910, Roche, Germany) and T7 and Sp6 RNA polymerase to generate both sense and antisense probes ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription from RNA to cDNA was performed with the Transcriptor Universal cDNA Master kit from Roche (Ref. 05893151001, lot. 32966400). The semiquantitative real-time PCR was proceeded with the faststart universal SYBR green master from Roche (Ref ...
-
bioRxiv - Developmental Biology 2020Quote: A 257 bp digoxigenin-labeled RNA probe was generated from a region spanning exons 1-3 of cat Dkk4 using a PCR-based template (cDNA from Stage 16 cat embryonic epidermal cells; CCCTGAGTGTTCTGGTTTT, AATATTGGGGTTGCATCTTCC) and in vitro transcription (Roche Diagnostics). 10 μ M paraffin-embedded sections were deparaffinized with xylenes and antigen retrieval using 0.01 M citrate buffer ...
-
bioRxiv - Genetics 2019Quote: ... Digoxigenin-labeled sense and antisense probes were synthesized using linearized pGEM-Teasy vector subcloned with this thoc1 fragment by in vitro transcription with DIG-RNA labeling Kit (Roche, Switzerland). Zebrafish embryos and larvae were collected and fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Physiology 2021Quote: ... DNase treatment was performed on 300 ng RNA prior to Reverse Transcription Polymerase Chain Reaction (RT-PCR) using RNAse-free DNAse I (Roche, # 04716728001) at 37°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription product was used to perform quantitative PCR (qPCR) with a real-time PCR detection system (LightCycler®480; Roche). The 10-μl qPCR reaction mixture contained 1 μl cDNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcription was performed on the pcr product with Ampliscribe T7-flash kit with Dig RNA labeling mix from Roche(75). In situ hybridization with both the anti-sense probes yielded the same results.
-
bioRxiv - Neuroscience 2022Quote: ... and plasmids were linearised to facilitate in vitro transcription of antisense riboprobes using either SP6 or T7 RNA polymerase and DIG-RNA labelling mix (Roche, 11277073910). All primers used to clone riboprobe sequences are listed in Extended Data Table 5.
-
bioRxiv - Developmental Biology 2023Quote: ... labelled RNA probes were achieved by reverse transcription and purification of the amplified partial coding sequence of selected genes with a DIG RNA labelling kit (Roche, Switzerland). For 75 and 150 hpf larvae ...
-
bioRxiv - Plant Biology 2023Quote: ... Expression of mRNA and pre-mRNA was then assayed by semi-quantitative reverse-transcription PCR (qRT-PCR) on a Roche LightCycler480 using SYBR Green I (Roche Diagnostics). Raw fluorescence data were analysed using LinRegPCR to perform background subtraction ...
-
bioRxiv - Physiology 2024Quote: ... Fluorescein-labeled cRNA probes for esr1 and esr2a were generated by in vitro transcription using Fluorescein RNA Labeling Mix (Roche Diagnostics), SP6 or T7 RNA polymerase (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmid was cut and antisense probe was synthesized by in vitro transcription with Dig RNA Labeling Mix (Roche, Cat. No. 11277073910) or Fluorescein RNA labeling mix (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Digoxigenin (DIG)-labeled anti-sense mak RNA probe was generated by in vitro transcription from this T7 promoter: mak cDNA fragment as the template using a DIG RNA labeling kit (Roche, 11175025910). Zebrafish embryos from the 1-cell stage to 72 hpf were fixed with 4% PFA at 4 °C overnight ...
-
bioRxiv - Immunology 2024Quote: ... reverse transcription was first carried out using High-Capacity RNA-to-cDNA and further quantified using Sybr Master mix I (Roche #04707516001). Relative gene expression over β-actin in cell lysates was calculated by the method while absolute N abundance in supernatants was quantified using the N normalizer plasmid.
-
bioRxiv - Microbiology 2024Quote: ... The mRNA transcript levels of selected IVSPER genes were measured by quantitative reverse transcription-PCR (qRT-PCR) using a LightCycler® 480 System (Roche) and SYBR Green I Master Mix (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibody solution containing anti-DIG-POD antibody (1:250, Roche, RRID:AB_514500) and mouse anti-GFP antibody (1:500 ...
-
bioRxiv - Microbiology 2020Quote: Primary antibody dilutions were used as follows: rat α-HA antibody (Roche) 1:2,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibody: rat-derived monoclonal anti-HA antibody (dilution 1:250; Roche). Secondary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated overnight with primary antibody α HA antibodies (Roche 3F10) (1:1000 dilution in 20% blocking solution I ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with anti-TLR7 antibody and anti-HA antibody (Roche) at 37 °C for 90 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used: monoclonal anti GFP antibody (1:500; Roche), monoclonal anti HA antibody (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... adjusted to pH 7.2) containing additionally 10 mM MgCl2 and 10 µg/ml DNase I (Roche) and lysed via sonication (Sonopuls ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Digoxigenin (DIG)- and biotin-labelled antisense probes of target IRs were transcribed from linearized pCS2+ vectors with the coding region of the corresponding receptors using the T7 RNA transcription kit (Roche, Mannheim, Germany). Labelled probes were subsequently fragmented to an average length of about 800 bp by incubation in sodium carbonate buffer (80 mM NaHCO3 ...