Labshake search
Citations for Roche :
251 - 300 of 8575 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were synthesized at 37°C for 2–4 hrs in digoxigenin-synthesis reaction mixture with T7 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with 1X PBS before nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Roche) for 10 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 μL of whole cell extract (WCE) was incubated overnight at 4°C with 2 μg anti-c-myc antibodies (mouse monoclonal, clone 9E10, Roche) for immunoprecipitation of myc-tagged proteins ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 2 µg/ml capture antibodies in PBS at 4°C overnight and blocked with blocking buffer containing 2% BSA fraction V (Roche) in PBS-T (0.05% Tween-20 (Daejung ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Immunology 2024Quote: ... Sera were analysed for antibody directed against the SARS-CoV-2 Spike protein receptor-binding domain (S-RBD) and nucleocapsid (N) using an established automated electrochemiluminescence assay (Elecsys Anti-SARS-CoV-2 S and N, Roche diagnostics) [54] ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue was transferred to a 50 mL conical tube and resuspended in DPBS/BSA containing collagenase B (2-4 mg/mL) (Roche, Mannheim, Germany) and DNase I (2,000 U/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... All the signals were visualized by adding 3-3′-Diaaminobenzidinetetrahydrochloride (DAB substrate) solution (Roche) to the slides and counterstained with haematoxylin ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: Proteasome activity was measured by spectrofluorometry using the 7-amino-4-methylcoumarin (AMC)-labeled fluorogenic substrate succinate-LLVY-AMC (Roche Sigma-Aldrich) in cleared extracts of leaf 1 at different dpg (Üstün and Börnke ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...