Labshake search
Citations for Roche :
101 - 150 of 8575 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6-Deamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000; Roche, #10236276001) for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... (2 mg/kg; atezolizumab, Roche; n = 12). Group 3 received anti-TGF-β I.P ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... were stained overnight with 4′,6-diamidino-2-phenylindole (DAPI, Roche, Basel, Switzerland) at a final concentration of 5 µg ml-1 ...
-
bioRxiv - Immunology 2024Quote: ... The cells were stained with 4′,6-diamidine-2′-phenylindole (DAPI; Roche, #10236276001). Images were taken with a Zeiss LSM 900 microscope (Carl Zeiss ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl, 4 mM MgCl2, 2 mM DTT, 1% SDS, 0.5% sodium deoxycholate, 0.5% Igepal, supplemented with Roche Complete Protease Inhibitor cocktail (1 tablet/50 mL)) ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Physiology 2024Quote: ... fixed with 4% PFA for 15 min and stained with 4′,6-diamidino-2-phenylindole (DAPI) (0.1 µg/mL; Roche, cat no. 10236276001) for 10 min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg) of HIV-1 NL4-3 full-length replication competent plasmid using X-tremeGENE HP (Roche Applied Science) transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...