Labshake search
Citations for Roche :
251 - 300 of 6226 citations for Cortisone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... 5 mg/kg diazepam (Valium10, Roche Farma SA) and 1 mg/kg atropine (B ...
-
bioRxiv - Genetics 2020Quote: ... using 5 µL 2x KAPA mix (Roche, #KK2602), 10 µL cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 µg of RNase A (Roche Diagnostics) were added per µg of sample ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Physiology 2021Quote: ... midazolam (5 μg/g; Roche, Grenzach-Wyhlen, Germany) and fentanyl (0.05 μg/g ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μl phosphatase inhibitor 10X (Roche, 04906837001). Protein extracts from MCF10A-ER-Src were obtained by incubating cell pellets in Lysis Buffer SDS-Free containing 1% protease inhibitors and 1% phosphatase inhibitors on ice for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM DTT and proteinase inhibitor cocktail (Roche)) at 2ml/g ...
-
bioRxiv - Microbiology 2020Quote: ... 5% glycerol) containing protease inhibitors (Roche, Basel, Switzerland). Total cell lysates (25 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... 10mM NaF) and complete protease inhibitors (5×; Roche). The detergent soluble supernatant fractions were immediately processed for SDS– PAGE and immunoblotting with antibodies.
-
bioRxiv - Molecular Biology 2019Quote: ... 5% glycerol) supplemented with protease inhibitor cocktail (Roche). Lysates were incubated with GFP-Trap magnetic agarose beads (Chromotek ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 μl SYBR Green PCR master mix (Roche) and ultrapure water up to 10 μl was used and analyzed using the LightCycler 480 System (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl of PCR DIG labelling mix (Roche), 3 μl template DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 U/mL rabbit pyruvate kinase (Roche Diagnostics), 8 U/mL lactate dehydrogenase (Sigma-Aldrich)) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 mM DTT and 1X protease inhibitor (Roche). Loose chromatin was removed with 1% SDS prior to sonication on a Bioruptor™ (Diagenode) ...
-
bioRxiv - Genetics 2020Quote: ... 5 mM EDTA with protease inhibitor cocktail (Roche), incubated at 4 °C for 30 min followed by centrifugation at 14000 rpm for 30 min to collect the supernatant ...
-
bioRxiv - Immunology 2022Quote: ... including 5% Western Blocking Reagent Solution (#11921673001, Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA with protease inhibitors (11697498001, Roche)) by sonication using TAITEC VP-5S sonicator (output ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... 5 mM EDTA] containing protease inhibitor (Roche, 11836153001) and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2022Quote: ... in 5% blocking solution (Roche, cat. no.11096176001) at room temperature overnight ...