Labshake search
Citations for Roche :
151 - 200 of 6226 citations for Cortisone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... HUVEC were seeded at a density of 60,000cells/well of the E-plate (E-plate 16, Roche Applied Science), then electrical impedance readings acquired every 2 min for 24 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... The plate was briefly pulsed in the centrifuge and sealed with a clear PCR plate seal (Roche Life Science). The LightCycler® instrument (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% blocking reagent (Roche, Germany)] containing 2.5 μg/mlCy-3-labelled telomere-specific (CCCTAA ...
-
bioRxiv - Neuroscience 2020Quote: ... including 5% WesternBlocking Solution (Roche) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL SYBR green (Roche), 1 μL 10 mM of both forward and reverse primer (see Table S3 for primer sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL SYBR green (Roche), 1 μL 10 mM of both forward and reverse primer and 15 ng gDNA was mixed in a 10 μL reaction volume and loaded in a white qPCR plate with optical caps (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... midazolam (5 mg/kg, Roche) and medetomidine (0.5 mg/kg ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µg DNase I (Roche) and 1x complete Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM DTT (Roche, 10708984001), 0.1 mM EDTA (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM DTT (Roche, 10708984001), 0.1 mM EDTA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM Tris (Roche, 107089176009), pH 7.4) ...
-
bioRxiv - Immunology 2024Quote: ... laminin (5 µg/ml, Roche), bovine collagen I (30µg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μg glycogen (Roche #10901393001) was added per sample ...
-
bioRxiv - Cell Biology 2019Quote: ... with ATP standard solutions used at concentrations between 10−8 and 10−5 M (luciferin/luciferase ATP bioluminescence assay kit CLSII, Roche, Basel, Switzerland). Data are expressed as nmol ATP produced/min/106 cells.
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was diluted to a final concentration of 5 ng/μl and RT–qPCR was performed with KAPA SYBR® FAST qPCR kits (KAPA Biosystems) on a C1000 thermal cycler ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Physiology 2020Quote: ... Tissues were homogenised in assay buffer provided in the kit with the addition of 5 μL of protease inhibitor cocktail (Roche, Basel Switzerland) and centrifuged at 800 × g for 10 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Femurs were then decalcified and paraffin sections (5-μm thickness) were stained with hematoxylin and eosin or reticulin (Reticulum II Staining Kit, Roche, Tucson, AZ) to assess fibrosis ...
-
bioRxiv - Immunology 2021Quote: ... it was added 50 µL of fresh TUNEL reaction mixture composed of 5 µL of enzyme solution mixed with 45 µL of labeling solution (In Situ Cell Death Detection kit, POD, ROCHE, version 15.0) for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2024Quote: ... 1 mM DTT, 10 mM NaPPi, 5 mM EGTA, 5 mM EDTA, 0.1 mM Na3VO4, 5 mM NaF, and Roche cOmplete™ Protease Inhibitor Mix). Crude extracts were prepared by centrifugation ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol) supplemented with 5% v/v beta mercaptoethanol and 1x protease inhibitor cocktail (Roche) was added to each sample followed by centrifugation at 18,000×g at 4 °C for 10 min ...
-
bioRxiv - Cell Biology 2019Quote: ... and levels of p24 were determined by ELISA as previously described (65) The SEAP levels of the supernatants were determined by a chemiluminescent method (Roche) and were used to normalize the differences in transfection efficiencies.
-
bioRxiv - Immunology 2020Quote: ... To quantify NETs we measured HNE-DNA complexes using ELISA specific for HNE and anti-DNA Ab of Cell Death Detection ELISAPLUS (Roche). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: RT activity was measured using an ELISA-based colorimetric reverse transcriptase activity assay (Catalog No. 11468120910, Roche Diagnostics, Indianapolis, IN). The HEPES integration buffer was used for the reaction ...
-
bioRxiv - Immunology 2020Quote: ... and co-transfected into 60-70% confluent BHK cells grown in 6-well plate tissue culture plates using Fugene HD transfection reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with 250-800 ng DNA per well of a 12-well plate or 500 ng per well of a 6-well plate using X-tremeGENE 9 DNA transfection reagent (Roche), and harvested after 24 h.
-
bioRxiv - Cell Biology 2019Quote: ... and the RealTime ready Custom Panels plates (Roche) used for the assay ...
-
bioRxiv - Systems Biology 2019Quote: ... in 96-well plates using SYBR Green (Roche) for selected transcript sequences with two technical replicates for each of the three independent biological replicates ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a Lightcycler 480 384-well plate (Roche), and analyzed using Lightcycler 480 Software v1.5 (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... onto a LightCycler multiwell 384 white plate (Roche). 3uL of the qPCR detection master mix (Table S4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2 pmoles of gene-specific forward primer and 0.2 pmoles of gene-specific reverse primer was combined with 2 µL of cDNA template into each well of a 96-well plate (LightCycler® 480 Multiwell Plate 96, white, 04729692001, Roche). qPCR amplification was performed using the following cycling conditions ...
-
bioRxiv - Genetics 2023Quote: Cell migration assays were performed with the xCELLigence Biosensor System using specifically designed 16-well plates equipped with membranes having 8-μm pores (CIM-plate 16; Roche Diagnostics). Cells in serum-free medium were seeded in the upper chambers ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μg of trypsin (Roche, Switzerland) was added and the mixture was further incubated at 37°C overnight ...
-
bioRxiv - Immunology 2019Quote: ... and 5 tablets PhosSTOP inhibitor (Roche) per 50 mL buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... dispase (5 U ml−1; Roche), and deoxyribonuclease II (50 mg ml−1 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 mg/kg midazolam (Dormicum, Roche) and 0.05 mg/kg fentanyl (Fentanyl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then 5 μl proteinase K (Roche) in 20 mg/mL stock was added and incubation was continued at 55°C for 1 hr ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 μg/ml Laminin (Roche) pre-coated #1.5 Φ12 mm round cover glass (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg/ml inorganic pyrophosphatase (Roche), and 1.5 u/μl of the mutant T7 RNA polymerase (T7 R&DNA polymerase ...
-
bioRxiv - Immunology 2021Quote: ... DNAse I (5 µg/ml, Roche) and 10% FBS (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% glycerol) supplemented with phosphatase (Roche) and protease (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μg/mL DNaseI (Roche). For cell lysis ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mg/ml collagen (Roche, 10103578001), and 15 U/ml Dispase II (Stemcell Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... + Insulin (5 ug/mL, Roche 11376497001) + BSA (10 mg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg/mL phytohemagglutinin (Roche) to generate T cell blasts (29).
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mg/ml collagen (Roche, 10103578001), and 15 U/ml Dispase II (Stemcell Technologies ...