Labshake search
Citations for Roche :
251 - 300 of 563 citations for 7 Phenyl 6 azaspiro 4.5 decan 9 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid transfections were performed using FuGENE 6 (Roche Diagnostics) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T cells were transfected using FuGENE®6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... were co-transfected with pLentiCRISPRv2 containing the indicated sgRNA sequences or pCW57 with the indicated cDNAs with XTremeGene 9 Transfection Reagent (Roche). After 12 hours ...
-
bioRxiv - Immunology 2021Quote: ... 1.0 × 106 THP-1 cells were transfected with mixture of two sgRNAs-expressing plasmids (0.5 µg each) using X-tremeGENE™ 9 DNA Transfection Reagent (6365779001, Roche) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... allowed to adhere overnight and transfected with the indicated splicing reporter constructs (1 µg/well) using X-tremeGENE 9 (Roche). As shown in the Key Resources Table ...
-
bioRxiv - Biochemistry 2021Quote: ... Then qPCR was performed in triplicate using 4 μl sample in 8-9 μl reaction with FastStart Universal SYBR Green Master Mix (Roche) and primers flanking each MseI cassette (Table S3).
-
bioRxiv - Molecular Biology 2021Quote: ... in 48-well plates and transfected at 50-60% confluence with a total of 100 ng Dual-pMIR-report plasmids using X-tremeGENE 9 DNA Transfection Reagent (Roche), followed by transfection with mimics (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... along with packaging plasmids including psPAX2 and pMD2.G (from Dr. Guang Hu in NIH) using the X-treme GENE 9 transfection reagent (Roche). Viral supernatant was collected and cellular debris was removed by syringe filtering (0.45 μm pore size ...
-
bioRxiv - Cancer Biology 2022Quote: Lentivirus was produced in HEK293T cells using helper plasmids (VSVG and psPAX2) with X-tremeGENE 9 DNA Transfection Reagent (Roche). Target cell lines were infected with the virus and 10 μg/ml polybrene ...
-
bioRxiv - Immunology 2020Quote: ... cells were cotransfected with both the reporter gene and one of the different putative transcription factors using X-tremeGENE 9 (Roche) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2019Quote: ... All viruses were packaged for 48 hours following transfection of HEK-293T cells using X-tremeGENE 9 DNA Transfection Reagent (Roche).
-
bioRxiv - Microbiology 2020Quote: ... 70-80% confluent CHO-K1 cells were transfected in 35 mm dishes using X-TREMEGENE 9 Transfection Reagent (Roche, 6365787001). Each dish was transfected with 2 μg of pCDNA 3.1 Venus plasmid using the using a 3:1 ratio of plasmid to transfection reagent in Opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transfection of pTON-BIOPS-Flag-EGFP-FOXO1/FOXO3 and pCDNA-HA-E2F1 in HEK293T cells was performed using ExtremeGene 9 (Roche). Transfection of siRNA smartpools targeting EMI1 ...
-
bioRxiv - Microbiology 2021Quote: ... GTP binding Irgb6 crystals diffracting to 1.5 Å resolution were obtained from sitting drops with a 9 mg/ml protein solution containing 2 mM GTP (Roche) and a reservoir solution consisting of 0.1 M Sodium Citrate buffer pH 5.4 (Wako) ...
-
bioRxiv - Cell Biology 2020Quote: ... pENTR-spCAS9-T2A-EGFP-gRNAs vector were transfected into H9 hESCs using X-treme GENE 9 DNA Transfection Reagent (Roche). After 24h transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... sgRNA expressing vector along with lentiviral packaging vectors Delta-VPR and CMV VSV-G were transfected into HEK-293T cells using the XTremeGene 9 transfection reagent (Roche). Similarly ...
-
bioRxiv - Biochemistry 2021Quote: ... and pPB-tetIRB-tetON-BSD plasmid bearing CLPTM1L-mEGFP or pPB-tetON-BSD-tightFF plasmid bearing CLPTM1L-FLAG-6His using X-tremeGENE 9 DNA transfection reagent (Roche), and incubated at 37 °C for 2 days ...
-
bioRxiv - Molecular Biology 2022Quote: Mouse pancreata from adult mice (9-14 week old) were perfused with a solution containing 1 mg/mL collagenase-P (Roche) in Hank’s buffered salt solution (HBSS ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK 293 cells stably-expressing GFP-DFCP1 and RFP-ATG9 were generated by transfection of HEK 293 GFP-DFCP1 cell with RFP-ATG9 using X-tremeGENE 9 (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The probes for the upstream regions of the pks1 (oligonucleotides 9 and 10) and ku80 (oligonucleotides 24 and 25) deletion constructs were synthetised using PCR DIG DNA Labeling Mix (Roche) and Taq DNA Polymerase (NEB) ...
-
bioRxiv - Physiology 2022Quote: ... The hairpin vectors were co-transfected with the lentivirus expression plasmid and packaging plasmid into actively growing HEK293FT using X-tremeGENE 9 DNA transfection reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Pooled library (18 total – nine from DNA and 9 from total RNA – see below) concentration was determined using a KAPA library quantification kit (Roche). Libraries were sequenced on a Illumina NextSeq 500 instrument (2×150bp paired-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... the HEK 293T cells were transfected with 1 µg UGGT1-pCDNA3.1/Zeo(+) or UGGT1-D1454A-pCDNA3.1/Zeo(+) construct using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... dTRPA1-A or dTRPA1-B in pMT vectors were co-transfected with pBS-puro using X-tremeGENE 9 DNA transfection reagent (Roche), and stable cells were selected and maintained in the presence of 10 µg/mL puromycin ...
-
bioRxiv - Cell Biology 2023Quote: RPE-1 cells were trans-fected with the different Flag constructs for 48 h using X-tremeGENE 9 DNA reagent (Roche). Cells were lysed in 25mM Tris (pH 7.5) ...
-
bioRxiv - Neuroscience 2023Quote: ... Each lane was excised into 9 sections that were destained and in-gel digested overnight using trypsin (sequencing grade; Roche). Peptides were extracted from gel bands twice with 50% acetonitrile:0.5% formic acid and dried in a SpeedVac (Thermo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK-293T and MEF cells (except for p62 KO MEF cells) were transfected with plasmids using X-tremeGENE 9 (Roche) as described as previously (41–43) ...
-
bioRxiv - Cancer Biology 2024Quote: ... human 293FT cells were grown on 10cm dishes and transfected with sgRNA-containing vector (pX330A-1x2-cNAT10/PITCh) and donor vector using Xtremegene 9 transfection reagent (Roche). 72 h after transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were co-transfected with 5 μg of Myc-tagged NAT10 and 5 μg of BRD4 short or long isoform using the Xtremegene 9 DNA transfection reagent (Roche). After overnight incubation ...
-
bioRxiv - Cell Biology 2024Quote: ... as in viral infection.9 TFIIB knockdown libraries were prepped with KAPA Stranded RNA-seq Kit with RiboErase (HMR) (Roche) using 500 ng of input RNA and amplified for 9 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral vectors expressing sgRNAs were transfected into HEK293T cells with lentiviral packaging vectors CMV VSV-G and psPAX2 using XtremeGene 9 transfection reagent (Roche). After 24 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were co-transfected with sgRNA expression vectors and lentiviral packaging constructs psPAX2 and pMD2.G (VSV-G) in a 2:1:1 ratio using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM MES pH 6 plus protease inhibitor cocktail (Roche); lysates were centrifuged 10 min at 800xg ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized with random p(dN)6 primers (Roche) and MMLV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... C-33A cells were transiently transfected using FuGENE 6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Digestion was performed with 6 units of MNase (Roche 10107921001) in 500 μl of a 20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid transfections were carried out by FuGENE 6 (Roche, E269A) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with random primers p(dN)6 (Roche) using SuperScript III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Cancer Biology 2023Quote: ... XG1 cells were supplemented with IL-6 (Roche, 3ng/ml).
-
bioRxiv - Molecular Biology 2020Quote: ... 5% CO2 for 24 h before transfection with a 4:1 DNA ratio of pCMV6-Affimer-tGFP and FLAG-ERK plasmids using Lipofectamine 2000 (SW620, HEK293, NCI-H460) or X-tremeGENE 9 (Roche; Panc10.05). After 24 h cells were serum starved for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µg of 330-BFP-CYP3A4-enhancer-R-sgRNA were transfected with X-tremeGENE 9 DNA transfection reagent (Roche 6365809001). After 3-5 days ...
-
bioRxiv - Microbiology 2021Quote: ... were used for the purification steps and the libraries were amplified (9 amplification cycles) with the KAPA HiFi PCR Kit (Kapa Biosystems) in KAPA HiFi Fidelity Buffer (5x) ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). Virus-containing supernatant was collected 48 hours after transfected and passed through a 0.45μm filter ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA expressing vectors along with lentiviral packaging vectors Delta-VPR and VSV-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001) ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...