Labshake search
Citations for Roche :
151 - 200 of 563 citations for 7 Phenyl 6 azaspiro 4.5 decan 9 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ligation products were amplified with 9 PCR cycles using KAPA Hifi kit (Roche, P5 universal primer and P7 indexed primer D7XX) ...
-
bioRxiv - Genomics 2019Quote: ... we transiently transfected 293T cells using ExtremeGENE 9 according to the manufacturer’s protocol (Roche). After 48 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and precB5R-N+GPC by using X-tremeGENE 9 (Roche Diagnostics K.K., Tokyo, Japan). Cells transfected with each plasmid were then infected with m8 at a multiplicity of infection (MOI ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmids were transfected into HEK293T cells using X-tremeGENE 9 (Roche # XTG9-RO) as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The residual 9 μL cDNA were subsequently amplified using Kapa HiFi HotStart Readymix (Roche) at a 1x concentration together with 250 nM UP-primer (Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... jetPEI-DNA transfection reagent (Polyplus-transfection) and X-tremeGENETM 9 DNA Transfection Reagent (Roche) were used to perform plasmid transient transfection according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 5 µl of X-tremeGENE 9 transfection reagent (XTG9-RO Roche, Sigma-Aldrich). Three days after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... pH 9 – adjusted with HCl) and then incubated with CDP-Star substrate (Roche, Germany) for 5 min in darkness ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pieces of tissue were incubated in 500 ml of NBT/BCIP solution (4.5 μl/ml NBT, 3.5 μl/ml BCIP in Alkaline Phosphatase buffer) (Roche 11383213001 and 11383221001) in the dark from some minutes to several hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids were transfected in HeLa and YFP-Parkin HeLa using Xtreme Gene 9 (Roche) according to manufacturer’s directions ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3mg or 1mg/ml/kg midazolam (Hypnovel, Roche, diluted with 0/9% w/v saline) fifteen minutes prior to a standard punishment session ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transfected with siRNA oligonucleotides using X-treme GENE 9 DNA Transfection reagents (Roche) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 150-300 ng of indicated construct using XtremeGene 9 transfection reagent (Roche) according to the manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2021Quote: Transfection of CRISPR/Cas9 constructs was performed using X-tremeGENE 9 DNA Transfection Reagent (Roche), with 4.0 μg plasmid per 200.000 cells/well in a six-well plates ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 10 µg sgRNA plasmid using X-tremeGENE™ 9 DNA transfection reagent (Roche 06365809001). One day after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfections were performed using the X-treme GENE 9 DNA transfection reagent (Roche Applied Science) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche), and 24h after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were deparaffinized followed by antigen retrieval in CC1 buffer (pH 9, 95°C; Roche), endogenous peroxidase blocking ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... plus 6 protease inhibitor tablets (Roche) per liter of lysis buffer ...
-
bioRxiv - Genetics 2020Quote: ... using FuGENE 6 transfection reagent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... either Fugene 6 (Roche Applied Science) or Transporter 5 transfection reagents were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 mg/ml dispase (Roche Applied Science ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-Deaza-dGTP using the LightCycler 480 software (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 7% 2H2O and supplemented with EDTA-free protease inhibitor cocktail (Roche). Final protein concentrations were 0.3-0.6 mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 µl of qPCR reaction mix containing 5 ul LightCycler 480 Probes Master (Roche, Cat#04707494001), 3.4 ul of Nuclease Free H2O (Ambion ...
-
bioRxiv - Cell Biology 2022Quote: ... The construct was then sequenced and transfected into penta KO cells with X-tremeGENE 9 (Roche) overnight and GFP positive single cells were sorted by fluorescence activated cell sorting (FACS ...
-
bioRxiv - Molecular Biology 2022Quote: ... structure in the 5’UTR and 70 ng of firefly luciferase (FLuc)-expressing normalizer plasmid (pcDNA5_FRT_TO_EGFP_AID_Luciferase, a gift from Andrew Holland) using X-tremeGENE 9 DNA transfection reagent (Roche, 06365787001) at a ratio of 5 µL reagent to 1 µg DNA to 100 µL Opti-MEM reduced serum medium (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a HP50 hairpin structure in the 5’UTR and 2 ng of FLuc-expressing normalizer plasmid (pcDNA5_FRT_TO_EGFP_AID_Luciferase, a gift from Andrew Holland) using X-tremeGENE 9 DNA transfection reagent (Roche, 06365787001) at a ratio of 5 µL reagent to 1 µg DNA to 100 µL Opti-MEM reduced serum medium (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: Lipofection: Plasmid was lipofected into cells using X-tremeGENE 9 DNA Transfection Reagent (Roche; Basel, Switzerland). The plasmid:transfection reagent ratio (w:v ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfections of HEK293T and 293FT cells were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche). Murine Stem Cell Viruses (MSCV ...
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.18 μL Fugene 6 reagent (Roche, Basel) was added to 4.82 μL serum free medium and incubated for 5 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed in a BioRad CFX96 system employing the SYBRgreen fluorescent reagent (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... using FuGENE® 6 (Roche, Basel, Switzerland), using standard procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed using standard protocols using EvaGreenTM in the Stratagene Mx3000P system (Agilent Technologies) ...
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The RNA-Seq libraries were normalized to a 2nM concentration and pooled for multiplexed sequencing on the NovaSeq 6000.
-
bioRxiv - Cancer Biology 2023Quote: ... the RNase A (6 µg/mL, Roche) was added or not directly to the reaction mixture ...
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). Libraries were pooled based on equal molar amounts to 1.9nM for multiplexed sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The libraries were pooled based on equal molar amounts to 1.85 nM for multiplexed sequencing.
-
bioRxiv - Microbiology 2023Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR was performed on a real-time PCR system (Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2024Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR reactions employing SYBRgreen fluorescent reagent and/or EvaGreen™ were performed in the Stratagene Mx3000P system (Agilent Technologies ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7) with addition of cOmplete tablets EDTA-free (04693132001, Roche, Switzerland), 0.5 mM Na3VO4 ...
-
bioRxiv - Genomics 2020Quote: ... DNA was amplified by 9 cycles of PCR using the Kapa Hifi Uracil + DNA polymerase (KAPA Biosystems) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification with 9 – 12 cycles using the KAPA HiFi HotStart Uracil + DNA Polymerase (Roche/KAPA Biosystems) was performed according to suggested protocols ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification with 9 – 12 cycles using the KAPA HiFi HotStart Uracil + DNA Polymerase (Roche/KAPA Biosystems) was performed according to suggested protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNA constructs were transfected into HeLa S3 cells (https://www.atcc.org/products/ccl-2.2) with X-tremeGENE 9 (Roche) overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNA constructs were then sequence-verified and transfected into penta KO cells with X-tremeGENE 9 (Roche) overnight and single cells that were positive for GFP were sorted by fluorescence activated cell sorting (FACS ...