Labshake search
Citations for Roche :
251 - 300 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Microbiology 2022Quote: Fresh pre-cut pancreatic tissue (2 × 2 mm) were digested with a solution of collagenase P in HBSS-1% HEPES (0.75 mg/mL, Roche) at 37°C for 7 min with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... in 100μl extraction buffer (Tris-HCl 50 mM pH 6.8, SDS 2%, DTT 2 mM and 1× protease inhibitors (Roche) and centrifuged for 5 min at 13,000g at 4OC ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.2% NP-40, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 20 µM MG132, 5 mM DTT and Roche protease inhibitor #5892953001), and incubated for 1 h on a rotating wheel ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... Follicular membranes were removed from isolated oocytes by collagenase treatment (2 mg ml−1; type 1; Sigma-Aldrich or Collagenase-P from Roche) for 3 hr ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 2 x 109 cells were harvested and washed with equal volume of cold PBS and resuspended in 1 ml lysis buffer (1 x PBS, supplemented with 1% NP40 and 2 x cOmplete, EDTA-free protease inhibitor cocktail (Roche, 11873580001)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2024Quote: ... 1µl each of 100 µM primers Sol-PrimerA (5′-GTTTCCCACTGGAGGATA-N9-3′) and Sol-PrimerB (5′-GTTTCCCACTGGAGGATA-3′) 18 and 0.8 µl Expand High Fidelity enzyme mix (Roche, Basel, Switzerland). Reaction conditions for the PCR were ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT supplemented with 1×cOmplete EDTA-free protease inhibitor cocktail (Roche), 1×PhosSTOP phosphatase inhibitor (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with Complete Protease Inhibitor Cocktail tablets (Roche) for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with cOmplete Protease Inhibitor Cocktail tablets (Roche) in Dounce homogenizer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT and 2 tablets of Complete Protease Inhibitor Cocktail Tablets (Roche) per 100 ml lysis buffer) ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT and 2 mM MgCl2) supplemented with 1x protease inhibitor (Roche) and 1 µl benzonase (Merck) ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 M sucrose, 5 mM KCl, 5 mM MgCl2, 0.6% Triton X-100, 0.4 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ml lysis buffer was made up using 5 ml RIPA buffer with 5 μl 1 M PMSF and 1x EDTA-free protease inhibitor cocktail (Roche, 11836170001). Cells were washed with 1 ml cold PBS before 250 μl lysis buffer was added to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40 and 5% glycerol) supplemented with protease inhibitors (Roche Complete EDTA-free). Protein concentrations were determined by bicinchoninic acid assay (BCA protein assay kit ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM EDTA) supplemented with PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001) followed by sonication of samples (25 % Amplitude for 10 seconds) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 minutes and hiPSC-CMs were dissociated using 1:200 Liberase TH (Roche) in PBS for 20 min ...
-
Transcriptional analysis in multiple barley varieties identifies signatures of waterlogging responsebioRxiv - Plant Biology 2023Quote: ... Each PCR reaction mix contained 5 μL of 2x SYBR green master 1 (Roche), 1 μL cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA) supplemented with 1 mM PMSF and protease inhibitor cocktail (Roche #11836170001). To ensure complete lysis ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.5% SDO, 1% Triton X-100, 1 mM PMSF, Roche cOmplete Mini Protease Inhibitors 1x), and homogenized (Precellys Evolution ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membrane was blocked with 5% skim milk in TBS for 1 h and incubated with anti-HA-HRP (Roche, 3F10, 1:5000) in 5% milk/TBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: GST-tagged CBX8 was purified by re-suspending thawed cell pellets in 30 ml of lysis buffer (1× PBS, 5 mM DTT, 1× EDTA free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN)) per liter of culture ...
-
bioRxiv - Microbiology 2021Quote: ... monocytes were harvested using ice-cold lysis buffer (1% Triton X-100, 2% SDS, 150 mM NaCl, 10 mM HEPES, 2 mM EDTA containing protease inhibitor cocktail - Roche). Cell lysates were heated at 100 °C for 5 min in the presence of Laemmli buffer (20% β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 20 mM KCl, 2 mM MgCl2, 1% TX-100, 40U Ribolock ml-2 and protease inhibitor cocktail, Roche) followed by clearing at 17 000 × g for 10 min at +4C° ...
-
bioRxiv - Physiology 2021Quote: ... 1:500 goat anti-rabbit (AlexaFlour 488; A-11008) and 1:1000 4′,6-diamidino-2-phenylindole (DAPI; Roche 10236276001; Basel, Switzerland). After secondary incubations ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were stained with secondary antibodies (1:300) for 2 h at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). Cells were mounted with ProLong Diamond Antifade Mountant (Thermo P36970 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Physiology 2024Quote: ... and 5- nitro blue tetrazolium/bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Roche) as chromogenic substrates ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 5% glycerol, and 0.1% Triton X-100 supplemented with Roche Protease Inhibitor cocktail) and then roc ked for 10 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM MgCl2 and 20 mM Imidazole) supplemented with 1 protease inhibitor tablet (Roche), 0.5 mM PMSF and 30 μL benzonase nuclease (Millipore Sigma) ...