Labshake search
Citations for Roche :
51 - 100 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After incubation for 1-2 hours in a 1% blocking solution (Roche) dissolved in 1× PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2 μg ml−1 collagenase A (Roche), 2.4 U ml−1 dispase I (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 mg ml-1 collagenase/ dispase (Roche) and 0.2 mg ml-1 DNase I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... and 10 U mL−1 IL-2 (Roche) for 48 h at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 mM PMSF and 1 % protease inhibitor (Roche). The samples were then lysed by sonication and centrifuged to collect the supernatant for the following protein purification ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Microbiology 2024Quote: rpoD was then amplified using psEG30F (5’-ATYGAAATCGCCAARCG-3’) and psEG790R (5’-CGGTTGATKTCCTTGA-3’) and KAPA2G Fast Hotstart Readymix (Roche-07960956001) to generate a 736 bp product as previously described (Girard et al ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a 2:1:1 ratio using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl of pyrophosphatase at 5 μg/ml (Roche), 4 μl of 1 mg/mL T7 RNA polymerase and 20 μl of transcription buffer 5X (Hepes pH7.5 400 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM KCl) with 1% protease inhibitor cocktail (Roche), 1% phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% deoxycholate) and 5% protease inhibitor cocktail (Roche, Germany). Whole cell extracts were incubated at 4°C for 30 min on a shaker ...
-
bioRxiv - Genomics 2023Quote: ... protease inhibitors (1 tablet per 5 mL, Roche 4693159001)) was added to the embryo pellet ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Immunology 2023Quote: ... Following antibodies were diluted in 1-5% BSA (Roche): anti-cGAS (Cell Signaling ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Biochemistry 2021Quote: ... 137.5 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, EDTA-free protease inhibitor cocktail [Roche]). 1 mM orthovanadate was added to the lysis buffer to prevent binding of substrates to the PTP1B trapping mutant ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed in lysis buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 1 mM sodium orthovanadate and 1× complete protease inhibitor cocktail from Roche) at 4°C for 15 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... The remaining extract was centrifuged at 2,000 rpm for 5 minutes and re-suspended in 1 x PBS Lysis buffer (1 x PBS, 0.01% NP-40, 5% Glycerol, 150mM NaCl, 1 x Roche cOmplete), sonicated and stored at -20°C for downstream applications.
-
bioRxiv - Cell Biology 2023Quote: Decapsulated testis extract was re-suspended into 1 x PBS Lysis buffer (1 x PBS, 0.01% NP-40, 5% Glycerol, 150mM NaCl, 1 x Roche cOmplete) and sonicated for 20 s at 22% amplitude in cycles of 0.4 s on and 0.2 s off ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...