Labshake search
Citations for Roche :
251 - 300 of 8334 citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and 2 × Complete protease inhibitor (Roche, Indianapolis, IN) on ice for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Microbiology 2021Quote: ... monocytes were harvested using ice-cold lysis buffer (1% Triton X-100, 2% SDS, 150 mM NaCl, 10 mM HEPES, 2 mM EDTA containing protease inhibitor cocktail - Roche). Cell lysates were heated at 100 °C for 5 min in the presence of Laemmli buffer (20% β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 20 mM KCl, 2 mM MgCl2, 1% TX-100, 40U Ribolock ml-2 and protease inhibitor cocktail, Roche) followed by clearing at 17 000 × g for 10 min at +4C° ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 M urea, 0.5% SDS, 1 mM EDTA pH8.0, 1 mM DTT, and 1× protease inhibitor cocktail [Roche, cat#4693132001]). Biotinylated RBPs were captured by affinity purification ...
-
bioRxiv - Genomics 2022Quote: ... and 1 mg/mL Collagenase B (Roche, #11088815001) supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... and 1 mg/mL Collagenase B (Roche, #11088815001) supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... pH 7.5) with the addition of 2 mg·ml-1 collagenase (Roche, Indianapolis). Defolliculated oocytes were injected with ENaC cRNAs into the cytosol (25 ng per oocyte in 50 nl of RNase-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... nuclei were stained with 4,6 diamine-2-phenylindole (1:25000, DAPI, Roche) in PBS 1X for 1 minute ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM Tris(2-carboxyethyl)phosphine (TCEP) and complete protease inhibitor (Roche)) and added to the oligo-bound magnetic beads for 2 hours at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche], 2 U/mL DNase I [Life Technologies] and Dispase II [Roche]). The digested brain parenchyma ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Microbiology 2020Quote: ... CD4+ T cells and B cells were activated for 48h with 10U/ml IL-2 (Roche) and 2 μg/ml phytohemagglutinin (PHA ...
-
bioRxiv - Systems Biology 2021Quote: ... for 2 hours followed by overnight digestion with 1.5 mg/ml collagenase B (Roche Diagnostics, Switzerland) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2020Quote: ... Cyclophilin B (control) and PPARγ siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 0.1% SDS, 2 mM EDTA, 1 mM PMSF, Roche protease and phosphate inhibitor cocktails ...
-
bioRxiv - Cell Biology 2020Quote: ... then resuspended in 4°C homogenization buffer (0.6 M sorbitol, 10 mM Tris pH 7.4, 1 mM EDTA, 1 mM PMSF, 2× Roche cOmplete protease inhibitor cocktail ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked in MBST + 10% HISS + 2% BMB for 2 h at room temperature and incubated in alkaline phosphatase-conjugated anti-DIG antibody (1:4000, Roche, Cat#11093274910) diluted in blocking buffer until signal development ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 7.4) with 1 mg/ml Collagenase B (Roche). Kidneys were harvested and thin tissue slices along the cortical-medullary axis were obtained and proceeded to digestion ...
-
bioRxiv - Systems Biology 2022Quote: ... pH 7.4) with 1 mg/ml collagenase B (Roche). We harvested the kidneys ...
-
bioRxiv - Cell Biology 2023Quote: ... and hygromycin B (0.3 mg mL-1, Roche, 10843555001). All cell lines were cultured in a humidified incubator at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT supplemented with 1×cOmplete EDTA-free protease inhibitor cocktail (Roche), 1×PhosSTOP phosphatase inhibitor (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with Complete Protease Inhibitor Cocktail tablets (Roche) for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with cOmplete Protease Inhibitor Cocktail tablets (Roche) in Dounce homogenizer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...