Labshake search
Citations for Roche :
101 - 150 of 8334 citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Physiology 2024Quote: Fibroblast proliferation was assessed using a 5-bromo-2’-deoxyuridine (BrdU) incorporation assay (colorimetric) from Roche (Indianapolis, IN, USA) for 48 h following the manufacturer’s instructions.
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg) of HIV-1 NL4-3 full-length replication competent plasmid using X-tremeGENE HP (Roche Applied Science) transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Immunology 2020Quote: ... The proliferation rate of lymphocytes was measured using 5-Bromo-2-deoxyuridine (BrDU) assay as per the manufacturer instructions (Cell Proliferation ELISA BrDU, Roche, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were stained with NBT (Nitroblue tetrazolium) and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland) in developing solution at 37°C for 2 hrs ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Cell Biology 2023Quote: Single cell suspensions were obtained from dissected muscles mechanically disrupted and enzymatically digested at 37 °C for 1h using DMEM 1% P/S medium containing 0.2% collagenase B (Roche) and Calcium dichloride (CaCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hearts were cut into 1–2 mm3 pieces and incubated with 0.5 U/mL collagenase B (Roche #11088807001) in 0.2% NaN3/PBS and left to oscillate at 1000 rpm at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25% CHAPS, 5 mM ATP, 5 mM MgCl2, 0.25 mM EDTA, 2 mM DTT, 10% glycerol, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Microbiology 2024Quote: rpoD was then amplified using psEG30F (5’-ATYGAAATCGCCAARCG-3’) and psEG790R (5’-CGGTTGATKTCCTTGA-3’) and KAPA2G Fast Hotstart Readymix (Roche-07960956001) to generate a 736 bp product as previously described (Girard et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... Real-time fluorescence-monitored quantitative PCR using the primer pair 5′-CCTATC ACCCTTGCCA-3′ and 5′-GAGGCTGTTGCTTGTG-3′ was performed on a LightCycler 96 System (Roche, Basel, Switzerland). Each reaction of 20 µL consisted of 10 µL of SYBR Green I (Roche) ...