Labshake search
Citations for Roche :
2901 - 2950 of 8477 citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Neuroscience 2020Quote: ... nt 1280-1350 from sequence NM_008553 detected with the mASCL1 probe (Universal Probe Library probe #74, Roche, Cat.No. 04688970001; 5′-(Fam)-GGCAGCAG-(Dark Quencher)-3′) ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Telomeric repeats were probed by incubating the membrane with telomeric probe containing digoxigenin (5’CCCTAACCCTAACCCTAACCCTAA-DIG; Integrated DNA Technologies, Coralville, IA; Table S1) overnight at 42°C DIG Easy Hyb™ buffer (Roche). Blots were washed in 2X saline-sodium citrate (SSC ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of cDNA were used as a template in a 5- l reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Bacteria were pelleted and resuspended in lysis buffer (30 mM Tris pH 7.5, 450 mM NaCl, 5 mM β-mercaptoethanol, complete™ EDTA-free Protease Inhibitor Cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2019Quote: ... microtubules were treated with 200 μg/mL subtilisin for 45 min at 303 K as described previously.28 Proteolysis was stopped with the addition of 5 mM PMSF (Roche Diagnostics). Subtilisin-treated microtubules were spun at 100,000xg for 30 min at 298 K and were resuspended in reaction buffer at 5 mM MgCl2 ...
-
bioRxiv - Genomics 2019Quote: ... after cells were lysed with Farnham Lysis Buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5% IGEPAL, Roche Protease Inhibitor Cocktail), and nuclei were resuspended in RIPA buffer (1x PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... cells were incubated for 48 h at 37°C in 5% CO2, harvested and lysed using M-PER Mammalian Protein Extraction Reagent (Thermo Scientific, 78501) (with 1X Roche Complete Protease Inhibitor and 100 mM NaCl) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Quantitative Real-time PCR reactions were prepared manually in a total volume of 10 µl by mixing 5 µl 2x KAPA SYBR FAST ABI Prism master mix (KAPA Biosystems), 0.2 µl forward and reverse primer mix (10 µM each primer) ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). Human cells from differentiation experiments were also lysed in 300 µl Tri-Reagent for 5 minutes at RT mechanically dissociated/lysed using a sterile scraper ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Plant Biology 2022Quote: ... RT was performed with 5 µg of total mRNA using Transcriptor Reverse Transcriptase and oligo (dT)15 primer (Roche, Mannheim, Germany). QRT-PCR was run on a LightCycler 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... The tissue was then washed with PBT extensively (10 times or more for 5 minutes) before development with BM-purple (1ml per well, Roche Diagnostics). Time of development was approximately 20 minutes at room temperature to 24 hours at 4°C depending on the probe ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 ml of digestion buffer containing collagenase D (2mg/ml, Roche #11088858001) and DNase (0.125 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue sections were equilibrated in hybridization solution (40 mL of prehybridization solution, 1.6 mL of 5 mg/mL, and 25 mg Roche yeast RNA) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... We equilibrated the sections in hybridization solution (50 mL of prehyb solution, 1.6 ml of 5 mg/ml, and 25 mg Roche yeast RNA) for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 min at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl from the partially amplified barcoded fragments was subjected to SYBR Green qPCR in a LightCycler 480 System (Roche, Germany) using the FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were washed and lysed in 2 mL of lysis buffer (containing in mM: 50 Tris pH 7.2, 5 EDTA, 150 NaCl, 10 NEM, Protease Inhibitor Cocktail (Roche, Basel, Switzerland), 2 PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... crosslinked chromatin was resuspended in 1 mL Farnham Lysis Buffer (FLB; 5 mM HEPES pH 8.0, 85 mM KCl, 0.5% NP-40/IGEPAL, Roche Protease Inhibitor Cocktail), centrifuged ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). The cell suspension was treated with a Sonopuls GM200 sonicator (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... cDNAs were diluted to 1 ng/ µL and used for qPCR analysis in a 10 µL reaction mix containing 5 µL of LightCycler® 480 SYBR Green I Master mix (Roche), 300 nM of each primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Microbiology 2023Quote: ... beads with protein were subjected to overnight digestion by adding 100 µl 5 ng/µl sequencing grade trypsin (Roche Diagnostic GmbH) in ammonium bicarbonate (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... indexes and sequencing sequences) was performed on 5 µl of purified first step PCR products using Expand™ Long Template PCR System (Roche) with the following thermocycling program ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 mM KCl, 5 mM MgCl2, 0.05% NP-40, EDTA-free cOmplete mini protease inhibitor [Roche, 11836153001], PhosSTOP [Roche, PHOSS-RO]). If indicated ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Biochemistry 2023Quote: ... The S100 extract was eluted from DEAE resin with 5 ml of S100 Elution Buffer (250 mM KHPO4 (pH 6.5),1x Mini protease inhibitor cocktail tablet (Roche, Basel, Switzerland)) and aliquoted and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Physiology 2024Quote: ... for 45 s at 6,000 rpm×3 (and placed on ice for 5 min at the end of each 45 s homogenization) using a Roche MagNA Lyser instrument (Roche, Germany). RNA was extracted using standard Tri-Reagent procedure via chloroform/isopropanol extractions and 75% ethanol washing as per manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). Cells were lysed by sonication using a SonoplusGM200 (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets of CoREST and LSD1 were resuspended in lysis buffer (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 5% glycerol, 7.5 mM imidazole supplemented with PMSF, DNAse and EDTA-free Roche protease inhibitor cocktail) in a weight ratio of 1:1.5 ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... 1% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA pH 8 and 1 tablet of protease inhibitor cocktail Roche cOmplete (Roche, Basel, Switzerland) and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with the primary antibodies diluted in blocking solution (H3K9me3: ab8898, 1:500, HP1α: CST #2616, 1:200, HA: Roche 3F10, 1:250) for 1h at room temperature ...