Labshake search
Citations for Roche :
2851 - 2900 of 8477 citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Screen for virus progeny production was done with SARS-CoV-2 antigen quick-test (Roche, 9901-NCOV-01G) (or CPE in E2T ...
-
bioRxiv - Neuroscience 2022Quote: ... Supernatants were removed and pellets were resuspended in 2% BSA/PBS containing RNase inhibitor (0.2 U/μL, Roche). To enrich astrocyte nuclei ...
-
bioRxiv - Biochemistry 2022Quote: ... 500 mM NaCl, 2 mM TCEP, 20% glycerol, 1.4 μg/mL leupeptin, 1.0 μg/mL pepstatin A and two Roche EDTA-free protease tablet per 5 g cell pellet) ...
-
bioRxiv - Biochemistry 2022Quote: ... 500 mM NaCl, 2 mM TCEP, 20% glycerol, 1.4 μg/mL leupeptin, 1.0 μg/mL pepstatin A and two Roche EDTA-free protease tablet per 5 g cell pellet) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mM b-mercaptoethanol (BME)] in the presence of an anti-protease cocktail (Complete EDTA-free, Roche) and 1 μl of benzonase (Merck Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ul of each sample were used for library quantification using the KAPA Library Quantification Kit (Roche #KK4923). The rest of the DNA eluate (20ul ...
-
bioRxiv - Developmental Biology 2023Quote: ... then incubated in 2 ml HBSS solution containing 2.5 mg/ml collagenase A (Roche, 11 088 793 001) and 10 mg/mL pancreatin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... primer efficiency was first calculated by amplifying cDNA template with KAPA 2× SYBR Master mix (Roche catalog 07959362001) and quantifying the SYBR intensity using a Roche LightCycler 480 at three different concentrations of cDNA 10-fold apart (1/2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and lysed in lysis buffer (50mM Tris, pH 7.4, 500mM NaCl, 0.4% SDS, 2% Triton-X-100, 1mM DTT, 1x complete protease inhibitor [Roche]). Lysates were sonicated twice for 1 minute at 30% duty cycle at an output level of 4 ...
-
bioRxiv - Genomics 2023Quote: ... Library QC was performed before and after capture in 2 steps: quantification using qPCR (Kapa Biosystems, part #KK4602) and QC using LabChip GX Touch HT Nucleic Acid Analyzer ...
-
Transcriptional Isoforms of NAD+ Kinase regulate oxidative stress resistance and melanoma metastasisbioRxiv - Cancer Biology 2023Quote: ... and 2 cocktails of protease and phosphatase inhibitor (Halt™, Fisher Scientific; Phosstop™-phosphatase inhibitor tablets, Roche). The Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Whole genome amplification was performed by addition of 20 μL 2× KAPA HiFi HotStart Uracil+ ReadyMix (Roche KK2801), 0.4 μL 100 μM Nextera P5 index primer and 0.4 μL 100 μM Nextera P7 index primer and incubation at 98°C for 45 s ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice (n=2 per group) were randomly assigned to receive either diazepam (synthesized by F. Hoffmann-La Roche) 0.3 ...
-
bioRxiv - Cell Biology 2024Quote: Cultured cells were lysed on ice through repeated pipetting in 2% SDS supplemented with Protease Inhibitor Cocktail (Roche) and PhosStop phosphatase inhibitor (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA (2 µl) was added to the mixture with FastStart SYBR Green Master Mix kit (Roche, Basel, Switzerland) and specific primers SP_F 5’-GAC-CAG-TCG-AAC-GCA-CAT-TG-3’ and SP_R 5’-CGG-AGA-GGG-TTG-TTG-TGT-CT-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 X protease inhibitor cocktail and 1 X phosphatase inhibitor cocktail from Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... reaction buffer containing 1 μL lambda phosphatase plus 1×phosphatase inhibitors cocktail (Roche) in at 30°C for 30 min with gently shaking ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 mM EGTA and 1 mM DTT) supplemented with cOmplete protease inhibitors (Roche), benzonase (Merck ...
-
bioRxiv - Immunology 2021Quote: ... and 10% glycerol) containing 1 mM PMSF and 1 × protease inhibitor cocktail (Roche). Then ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 mM EGTA and 1 mM DTT) supplemented with complete protease inhibitors (Roche), benzonase (Merck ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EGTA and 1% Triton X-100 with protease/phosphatase inhibitor (Roche) mixture ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mM DTT) with 1 mM PMSF and protease inhibitor cocktail tablets (Roche) by vigorous shaking in a fast prep cell breaker (Bio 101 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM DTT and 1× cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Fifty micrograms of total protein were loaded onto SDS-PAGE gels and separated by electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mM EDTA and 1×Complete EDTA free-tablet (Roche Diagnostics, Basel, Switzerland) in distilled water ...
-
bioRxiv - Microbiology 2024Quote: ... Lysozyme 1 mg/ml and 1 tablet of EDTA-free protease inhibitor (ROCHE). Cells were broken passing twice through an Emulsiflex C5 (ATA scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a 1:1 mixture of oligo dT and random hexamer primers (Roche). Quantification was performed on a LightCycler 480 (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... in a 1:1 ratio and added to white 384 well plates (Roche). Plates were run on a 45-cycle protocol using the LC 480 II system (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 mM EDTA and supplemented with 1× Complete protease inhibitor cocktail (Roche) by using a Teflon pestle (Schuett Biotec) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM Na3VO4 and 1 mM NaF) supplemented with protease inhibitor cocktail (Roche) and incubated on ice for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM DTT and 1 tablet of complete EDTA-free (Roche, Basel Switzerland)] ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM DTT and 1 tablet of complete EDTA-free (Roche, Basel Switzerland)] ...
-
bioRxiv - Molecular Biology 2019Quote: ... The pellet was lysed with Lysis buffer (50 mM Tris HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton, 1 × Roche inhibitor tablet) on ice for 15 minutes and centrifuged at 8000 rpm for 5 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... 25mM NaCl, 1 mM EGTA, 1.5 mM MgCl2, 1 mM DTT, 1% Triton TX-100, 10% Glycerol, 1X Roche Complete protease inhibitors) during 1h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor tissues were minced into 1×1 mm fragments and enzymatically dissociated in HBSS containing 1 mg/ml collagenase A (#11088793001; Roche, Basel, Switzerland) and 1 μg/ml DNase I (#07900 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were lysed in 1500 μl ice cold RIPA buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS, 1 mM EDTA, Roche cOmplete and 1 mM PMSF). Cell lysates were clarified by centrifugation (13000 x g at 4°C for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM EDTA) supplemented with 1 mM PMSF and 1 tablet of cOmplete Protease inhibitor (Roche, cat. No. 11 873 580 001) per 50 ml using a MP Biomedical Fast-Prep-24 5G bead beater ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... Coralville, Iowa, USA) and 0.25 µl reverse primer (5 µM, IDT) and was analyzed on a LC480 instrument (Roche, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: C2C12 cell lysate was generated using 5 million cells in RIPA lysis buffer with protease/phosphatase inhibitors (Roche #11836145001 and #04906837001), and 20μg of protein was loaded on a denaturing SDS page gel for detection of the VGLL2-NCOA2 fusion ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were conducted in a 10-µL final volume with 5 µL of 2X FastStar Universal SyBR green Master (Roche, Switzerland), 1.5 µL of forward/reverse primer mix (Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... After that pelleted beads were gently resuspended in washing buffer containing 4xTBS, 5% NP-40, phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and washed 10 times with gentle agitation ...
-
bioRxiv - Neuroscience 2019Quote: ... The tissue was homogenized in homogenization buffer (20 mM HEPES, pH 7.4; 320 mM sucrose, 5 mM EDTA) supplemented with protease inhibitors (Roche, Cat #11697498001) using a glass Dounce homogenizer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... before lysis in swelling buffer (5 mM PIPES pH8.0, 85mM KCl) freshly supplemented with 1x protease inhibitor cocktail (Roche, cat. 04693116001) and 0.5% NP-40 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tissue was then washed with PBST extensively (10 times or more for 5 minutes) before development with BM-purple (1ml peer well, Roche Diagnostics). Time of development was approximately 24 hours at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 50 µl of the post-nuclear supernatant was saved as the input lysate and 450 µl was incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...