Labshake search
Citations for Roche :
201 - 250 of 1132 citations for Recombinant Human CD96 Protein T7 His TEV tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Digoxygenin labeled probes were synthesized using a RNA Labeling kit (SP6/T7; Roche). RNA probes were generated by linearization of TOPO-TA or ZeroBlunt vectors (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA probes were synthesized with the DIG RNA labelling kit (SP6/T7) (Roche). The experiment was conducted as described in the reference 67 with biological replicates (n=30 for zebrafish ...
-
bioRxiv - Developmental Biology 2020Quote: ... Probes were synthesized with T7 polymerase and DIG labeling mix (Roche 10881767001, 11277073910).
-
bioRxiv - Molecular Biology 2020Quote: ... Gel purified PCR products (200ng) are purified and used in T7 (Roche 10881775001) in vitro transcription reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... from 72 hpf WT embryos and synthesized using T7 RNA polymerase (Roche, 10881767001) and DIG RNA labelling mix (Roche ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and in vitro transcribed with sp6 or T7 RNA polymerase (Roche, Basel, Switzerland)) according to the insert direction ...
-
bioRxiv - Physiology 2024Quote: ... with fluorescein using T7 RNA polymerase and Fluorescein RNA Labeling Mix (Roche Diagnostics) and with DIG as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... Insert amplification was performed using the Kappa Hi Fi Hotstart ReadyMix (Roche). For a 25 μL reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleared lysate was applied to cOmplete His-Tag purification resin (Roche), pre-equilibrated in lysis buffer and incubated at 4 °C for 6 h on a tube roller ...
-
bioRxiv - Cancer Biology 2021Quote: ... Insert amplification was performed using the Kappa Hi Fi Hotstart ReadyMix (Roche). For a 25 μL reaction ...
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were amplified with KAPA 2× Hi-Fi Hotstart Readymix (Roche) and purified with 18% Sera-Mag Magnetic Beads in polyethylene glycol.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was filtered and incubated with His-tag purification resin (Roche) overnight at 4°C while mixing gently ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hi-C libraries were prepared using KAPA LTP Library Preparation Kit (Roche) 65 with 12 amplification cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Cell Biology 2023Quote: ... Clarified lysate was loaded onto a cOmplete His-tag purification column (Roche), immobilized proteins washed with lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Developmental Biology 2019Quote: ... In vitro transcription was performed with SP6 or T7 RNA polymerase (Roche, 10810274001, 10881767001) using either digoxigenin or dinitrophenol labeling ...
-
bioRxiv - Plant Biology 2020Quote: ... DIG-labeled sense and antisense RNA probes were synthesized with T7 RNA polymerase (Roche). For immunological detection ...
-
bioRxiv - Molecular Biology 2021Quote: DNA templates bearing T7 promoter were produced by PCR amplification (Kappa HiFi Hotstart, Roche) of plasmids encoding for Renilla reporter using primers detailed in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... T7 in vitro transcription was performed in presence of conjugated DIG-11-UTP (Roche) following the manufacturer instruction (1 mM of each dNTP ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA probes were transcribed in vitro using DIG RNA Labeling Kit (SP6/T7) (Roche). Anti-Digoxigenin-AP and NBT/BCIP Stock Solution were also from Roche ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... and probes were synthesized using SP6 or T7 RNA polymerase (Roche Diagnostics, Rotkreuz, Switzerland) with a digoxigenin (DIG)-labeling mix (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2019Quote: ... neurod1 and phox2a were made using the DIG RNA Labeling Kit (SP6/T7) (Roche). Zebrafish embryos at different developmental stages were collected and fixed with 4% PFA overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DIG labeled probes were made using SP6 or T7 transcription kits (Roche, Mannheim, Germany) from linearized plasmid or ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcription was performed using the DIG RNA Labeling Kit (SP6/T7, Roche). Sense SlSBP15 probe was used as a negative control ...
-
bioRxiv - Developmental Biology 2023Quote: Double-stranded RNA (dsRNA) was synthesized by in vitro transcription (Sp6/T7 from Roche) as previously described (Sánchez-Alvarado and Newmark ...
-
bioRxiv - Plant Biology 2023Quote: ... In vitro transcription was performed using the DIG RNA Labeling Kit (SP6/T7, Roche). The sense SlSBP15 probe was used as a negative control ...
-
bioRxiv - Genomics 2024Quote: ... and in vitro-transcribed using T7 or SP6 polymerase (DIG RNA Labeling Mix, Roche), respectively ...
-
bioRxiv - Developmental Biology 2023Quote: ... In vitro transcription was performed using a T7 polymerase and DIG-labeled nucleotides (Roche). RNAscope was performed on sectioned zebrafish larvae as previously described (Carroll ...
-
bioRxiv - Genetics 2024Quote: ... These templates were transcribed in vitro using T7 and digoxigenin-RNA labeling mix (Roche). The quality of the synthesized DIG-labeled RNA probes was confirmed by electrophoresis and dot-blot ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Biophysics 2019Quote: ... the crude extracts mixed with cOmplete His-Tag purification resin (Roche, Basel, Switzerland) were loaded onto a polyprep chromatography column (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full length cDNA amplification with Hi-Fi Hotstart Readymix (Roche, cat. no. 07959079001) was completed with a 98°C incubation then 21 cycles of (98°C for 15 sec ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 µL of the Ni-NTA slurry (Roche cOmplete His-Tag purification resin) was washed with 2x1 mL of wash buffer (WB ...
-
bioRxiv - Molecular Biology 2023Quote: ... After gap repair with Kapa Hi-Fi HotStart Uracil+ DNA Polymerase (KAPA Biosystems) and Taq DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was loaded into cOmplete™ His-Tag Purification Resin (Roche) pre-equilibrated with wash buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... or zebrafish genomic DNA using the Expand Hi-Fidelity PCR System (11732641001, Roche). Exact coordinates are listed in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants after high-speed centrifugation were loaded onto His-Tag Purific Resin (Roche), washed and eluted with 50 mM Tris.HCl pH 7.5 ...
-
bioRxiv - Genomics 2024Quote: ... The cleared lysate was loaded onto a cOmplete His-tag purification column (Roche) and the His6-Sumo3-Tn5 was eluted with a running buffer containing 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...