Labshake search
Citations for Roche :
201 - 250 of 2467 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biochemistry 2021Quote: Cells were washed 2x with PBS to remove excess biotin and lysed in highly stringent washing buffer 5 (WB5; 8 M urea, 1% SDS in 1X PBS) supplemented with 1x protease inhibitor cocktail (Roche) and 50 μM NEM ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were harvested by centrifugation at 7000g at 4°C for 10 minutes and resuspended in 25 mL of cold TBS buffer (50 mM Tris-HCl, 500 mM NaCl, pH 8) with 5% glycerol and EDTA-free protease inhibitors cocktail (Roche). Cells were lysed by sonication and purified using Glutathione-Sepharose 4B (Cytiva ...
-
bioRxiv - Microbiology 2021Quote: ... before being resuspended in 1 mL of lysis buffer (100 mM NaCl, 5% glycerol, 10 mM Tris, pH 8; one cOmplete Mini EDTA-free protease inhibitor pellet (Roche) per 15 mL) ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Cell Biology 2023Quote: Cells were washed 2x with 1x PBS to remove excess biotin and lysed in highly stringent washing buffer 5 (WB5; 8 M urea, 1% SDS in 1x PBS) supplemented with 1x protease inhibitor cocktail (Roche) and 50 μM NEM ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked for 1 h in blocking reagent (100 mM Tris HCL pH 8; 150 mM NaCL; 5 g/L Blocking Reagent (#11096176001, Roche)) and treated for 1.5 h with primary antibody diluted in blocking reagent (NF-κB p65/RELA ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 mM Tris pH 8, 450 mM NaCl, 1% CHAPS, 20 mM MgCl2, 5 mM ATP, 1 mM Dithiothreitol [DTT], 1X Roche Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by an 8-minute perfusion with myocyte digestion buffer containing 5 mg of liberase dispase high DH enzyme (Roche) per digestion ...
-
bioRxiv - Genomics 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) supplemented with fresh protease inhibitors (AEBSF, Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Emulsions were snap-frozen in droplets in liquid nitrogen and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Genomics 2021Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) per gram of cells in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... β-Glucuronidase was purchased from Roche Diagnostics (Mannheim ...
-
bioRxiv - Microbiology 2020Quote: ... α-HA (both Roche, Freiburg, Germany), α-Myc (Sigma-Aldrich Chemie GmbH ...
-
bioRxiv - Plant Biology 2019Quote: ... rat α-HA (all from Roche), and α-FLAG (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... α-HA (clone 3F10, #11867423001, Roche), α-V5 (Clone SV5-Pk1 ...
-
bioRxiv - Microbiology 2021Quote: ... α-GFP (Roche, 1:2000 dilution), α-mCherry (Biovision ...
-
bioRxiv - Plant Biology 2023Quote: ... rat α-HA (Hoffmann-La Roche AG ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...