Labshake search
Citations for Roche :
201 - 250 of 283 citations for 7 Methyluric acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total nucleic acids were purified from nasopharyngeal swab samples using a MagNA Pure 96 System (Roche Applied Sciences). All samples were treated with DNase I (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... Hybridization and probe detection was performed using a DIG Luminescent Detection Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleic acids were UV-crosslinked to the membrane and incubated with prehybridization buffer DIG Easy Hyb (11603558001, Roche,) in a hybridization tube at 37° C for 30 min with rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleic acid precipitation was carried on ice in HisA supplemented with 1M LiCl and cOmplete protease inhibitor (Roche) for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Lactate was quantified using a lactate assay kit (D-Lactic/L-Lactic acid UV method, r-biopharm, Roche). All samples were measured using fresh growth medium as control.
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time PCR assay targeting the virus of interest (see primers/probe sets in Table 7) was performed in a final volume of 12 µL using the LightCycler® 480 Probe Master Mix 1X (Roche Applied Science, Germany), with primers and probes at 200 nM and 2 µL of control DNA ...
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Neuroscience 2021Quote: ... human iPSC-derived neuronal cultures and N2a cells were collected in Lysis Buffer (50 mm Tris-Base, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid) with protease inhibitor (Roche) and phosphatase inhibitor cocktails II and III (Sigma ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... L6 cells and cardiomyocytes by incubating them in their respective media containing 2% (w/v) fatty acid-free bovine serum albumin (FAF-BSA; Roche) and 0.4 mM sodium palmitate (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Immunology 2019Quote: ... Samples were washed in 1X maleic acid buffer with 0.1% Tween-20 (MBST) and then incubated in Roche Blocking Reagent (Roche, 1096176) with 10% heat inactivated sheep serum (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Viral transport media was added to each pool at a 1:1 ratio for nucleic acid extraction performed on the Roche MagNA Pure 24 platform using the MagNA Pure 24 Total NA Isolation kit (Roche). Elution volume was set to 50 ul to concentrate viral RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Neuroscience 2021Quote: ... Two AfeI restriction sites were sequentially added by two rounds of PCR-amplification on each side of individual IDR (see Fig. 1b and S1b for amino acid position) using KAPA HiFi polymerase (Roche). The PCR reaction was DpnI digested (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 200 μl of another aliquot of lung homogenate supernatant using the MagNA Pure Total Nucleic Acid Isolation protocol and reagents on a MagNA Pure LC 2.0 instrument (Roche Diagnostics). Prior to extraction ...
-
bioRxiv - Microbiology 2020Quote: ... whole specimens were processed into head/thorax homogenates for RNA extraction with the High Pure Viral Nucleic Acid Kit (Roche), according to manufacturer’s instructions (Moreira et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Genomics 2019Quote: ... Samples were washed in 1X maleic acid buffer with 0.1% Tween-20 (MBST) and then incubated in Roche Blocking Reagent (Roche, #1096176) with 10% heat inactivated sheep serum (Sigma ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from homogenized tissue of adenovirus vectored vaccine inoculated mice by High Pure Viral Nucleic Acid Kit (Roche). DNA fragments of Sad23L and Ad49L vectors were amplified by nested PCR with primers specific to adenoviral hexon sequences (Table S4 ...
-
bioRxiv - Genomics 2022Quote: Cells were lysed in RIPA buffer (Beyotime, China) containing protease inhibitors (Complete Mini Ethylene Diamine Tetraacetic Acid-Free Protease Inhibitor Cocktail, Roche). The protein lysates were centrifuged ...
-
bioRxiv - Microbiology 2022Quote: ... lacking the predicted signal peptide (amino acids 1-29) was amplified from genomic DNA (isolated using the High Pure Template kit, Roche) by PCR using the Phusion Hot start II High Fidelity DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot-blot) or electro transferred (for northern-blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled full-length riboprobes as previously described [8 ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot blotting) or electro-transferred (for Northern blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled riboprobes as previously described (22).
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...