Labshake search
Citations for Roche :
51 - 100 of 283 citations for 7 Methyluric acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail cOmplete (Roche). For blocking and antibody dilutions ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Neuroscience 2021Quote: ... Okadaic acid (200nM) and a protease inhibitor cocktail (Roche Complete) with a Dounce homogenizer and solubilized for 1 hour rotating at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Immunology 2021Quote: ... 0.25% sodium deoxycholic acid and complete protease inhibitor cocktail (Roche), pH 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... in Tris calcium buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche) were added and the pellet resuspended ...
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... pH 8.0) supplemented with ethylenediaminetetraacetic acid and cOmplete protease inhibitor cocktail (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then blocked with 0.5% nucleic acid blocking reagent (Roche 11096176001) dissolved in a 1x PBS containing maleic acid (Sigma M0375 ...
-
bioRxiv - Genetics 2020Quote: ... acid-extracted histones were digested with Asp-N and Arg-C (Roche) and the resulting digests were analyzed by chromatography on an Ultimate 3000 nanoLC (Dionex ...
-
bioRxiv - Microbiology 2020Quote: Escherichia coli MRE600 total transfer ribonucleic acid was purchased from Roche (Switzerland). Biotin labeled single-stranded DNA oligonucleotides were obtained from B.G.I. ...
-
bioRxiv - Genetics 2023Quote: ... 1×EDTA (Ethylene Diamine Tetraacetic Acid)-free protease inhibitor cocktail (Roche 04693132001). The larvae were then crosslinked by adding formaldehyde to a 1.8% concentration and incubating for 5mins at RT on a rotator ...
-
bioRxiv - Neuroscience 2024Quote: ... ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (plus protease inhibitors) (Roche). For experiments where separate measurements were made in ganglia versus neurites ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.0) supplemented with one tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche). The cell solution on ice was sonicated 3 × 1 min at 90% amplitude (0.5 s cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... and supplemented with an ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablet (Roche). Cells were lysed via high-pressure homogenization ...
-
bioRxiv - Genomics 2019Quote: ... 5.6mmol/L glucose with 2% BSA fraction V fatty acid free (Roche Diagnostics), 50μmol/L 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2021Quote: ... viral DNA was purified from SN (High Pure Viral Nucleic Acid Kit, Roche) and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from a 200µL sample using the MagnaPure24 (Roche) External Lysis Pathogen 200 protocol with elution into 50 µL ...
-
bioRxiv - Microbiology 2022Quote: Viral DNA was extracted by the High Pure Viral Nucleic Acid Kit (Roche) and eluted in 40 μM (μL ...
-
bioRxiv - Cell Biology 2020Quote: ... supernatant removed and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche, Lewes, UK) added to cell-free media ...
-
bioRxiv - Pathology 2023Quote: ... 0.1% SDS and 0.5% deoxycholic acid) with cocktail protease and phosphatase inhibitors (Roche) at 4℃ condition ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM ethylenediaminetetraacetic acid (EDTA)) supplemented with an EDTA-free antiprotease tablet (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2023Quote: ... Basal respiration was measured in DMEM containing 2% fatty-acid-free BSA (Roche). Cells were treated with 100 μM isoproterenol to stimulate respiration ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 2% bovine serum albumin (BSA; fraction V, fatty-acid-free; Roche), 50 µM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...
-
bioRxiv - Microbiology 2019Quote: ... cells were harvested at 0 to 7 DPI in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extracted from the parasites at passages 7 and 20 were digested with 5 U Rsa1 (Roche) at 37 °C overnight ...
-
bioRxiv - Physiology 2024Quote: ... from two bees were pooled and homogenized in 250 µL of phosphate-buffered saline (7 mM NaCl, 2.7 mM KCl, and 10 mM PO4, pH 7.4) containing cOmplete protease inhibitors (Roche) at kept on ice until further processing ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Genomics 2020Quote: ... Day 4 (HH21-24) and day 7 (HH30-31) ventricular samples were digested in 1.5mg/mL collagenase type II/ dispase (Roche) for one cycle of 20 minutes and one cycle of 10 minutes under mild agitation at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Genomics 2020Quote: ... Library fragments were then subjected to 7 cycles of PCR amplification with KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems). Single-end 100 bp sequencing was performed on a HiSeq 1500 or a MiSeq (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were homogenized by sonication in PBS (pH=7) mixed with a protease inhibitor cocktail (Complete®, Roche, Spain). After adjusting protein levels ...