Labshake search
Citations for Roche :
201 - 250 of 7383 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... incubated with blocking buffer containing 3 % BSA (Roche Diagnostics), 5 % goat serum (Jackson ImmunoResearch Laboratories) ...
-
bioRxiv - Neuroscience 2020Quote: Clonazepam (CAS #1622-61-3) was bought from Roche on 2018 ...
-
bioRxiv - Biophysics 2024Quote: ... 20 mM imidazole) supplemented with 3 protease inhibitors (Roche) and then lysed by an EmulsiFlex-C3 (Avestin ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 7.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µg/ml of glycerol 3-phosphate dehydrogenase (Roche) and 5 µg of cell free protein extract ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked with 3% BSA (Roche, catalog no.10735094001) in PBS for 1 h at room temperature (for RPA2 ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 3 hours with Anti-Digoxigenin-AP Fab fragments (dilution 1:3000) (Roche, 11093274910) at room temperature ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL of Proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endogenous peroxidase activity was quenched in 3% hydrogen peroxide (Roche) in PBS for 15 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by collagenase D (3 mg/mL, COLLD-RO, Roche) two times at 37 degrees ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μL of Proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL of Proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 3 mL of proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 3% bovine serum albumin (Roche Diagnostics, Meylan, France) and 1.3 mg/ml collagenase A (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: Dissected embryos were incubated with a liberase-blendzyme 3 (Roche) solution for 90min at 33 °C ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in 10 μM BrdU:BrdC (3:1) for 16–20 h before incubation with 0.1 μg/mL colcemid (Roche) for 2-3 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were harvested and lysed in IP buffer (1 x PBS, 3 mM KCl, 2.5 mM MgCl2, 0,5 % Triton X-100 and protease inhibitors from Roche). 35 μl of this lysate was loaded onto an SDS-gel (lysate lanes) ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... planulae were washed twice with 1/3 strength artificial seawater and incubated with 50 μg/mL liberaseTM (Roche) at 37 °C for 10–20 min with occasional pipetting ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...