Labshake search
Citations for Roche :
51 - 100 of 7383 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Mannheim, Germany Cat#11383221001) was used in conjunction with nitro blue tetrazolium (NBT ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Biophysics 2022Quote: ... except that the carboxylic silica beads were replaced by polystyrene carboxylic beads and polyclonal anti-digoxigenin from sheep (11333089001, ROCHE) were used in our experiments.
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Physiology 2024Quote: ... and 5- nitro blue tetrazolium/bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Roche) as chromogenic substrates ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Cancer Biology 2024Quote: ... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Cancer Biology 2020Quote: ... All the signals were visualized by adding 3-3′-Diaaminobenzidinetetrahydrochloride (DAB substrate) solution (Roche) to the slides and counterstained with haematoxylin ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Biophysics 2021Quote: ... 1/3 of a Complete EDTA-free protease inhibitor cocktail tablet (Roche) and were lysed by five passes through an Avestin C3 homogenizer at 15-20,000 PSI ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...