Labshake search
Citations for Roche :
2401 - 2450 of 8584 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... dehydrated and incubated with PNA hybridization mix with 5% blocking reagent (Roche) containing 2.5 μg/ml Cy3-labelled telomere-specific (CCCTAA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 L of RNase A (20 mg/mL) (Roche Cat. 70294823) were added to flow cytometry samples and continued for incubation at room temperature for 30 minutes and protected from light ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mM L-cysteine and 500 μg/mL DNase I (Roche, 10104159001)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... TMA sections 5-μm were made on Benchmark XT Ventana (ROCHE Diagnostics). After dewaxing ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM imidazole) supplemented with cOmplete EDTA-free protease inhibitor tablets (Roche) and disrupted by sonication ...
-
bioRxiv - Immunology 2022Quote: ... 250ng of random hexamers and 5 units of Transcriptor Reverse Transcriptase (Roche) was prepared as described in manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM DTT and 1X protease inhibitor cocktail (Roche cOmplete EDTA-Free). An equal volume of 425– 600 µm glass beads (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2019Quote: ... 5 mM β-mercaptoethanol) in the presence of protease inhibitors (Roche, A32965), and 3 volumes 0.1 mm Zirconia beads (Thistle Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μl FastStart Universal SYBR Green Master mix (ROX) (Roche, Basel, Switzerland) and 3 μl MilliQ ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA) supplemented with cOmplete ULTRA protease inhibitor cocktail (Roche Diagnostics). Proteins in each lysate were resolved by SDS-PAGE and transferred onto Immobilon-P PVDF membranes (Merck) ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were performed in 5 μl total volume on LightCycler 480 (Roche) as described previously (Petek et al ...
-
bioRxiv - Immunology 2022Quote: ... 5% b-ME) supplemented with protease and phosphatase inhibitors (Roche/Sigma-Aldrich). A Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM Sodium Pyrophosphate and complete EDTA-free protease inhibitor cocktail (Roche). After 15 min of incubation in hypotonic solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% Glycerol and Complete EDTA-free antiprotease cocktail (Roche, Boulogne-Billancourt, France)) ...
-
bioRxiv - Biochemistry 2022Quote: ... and 5% SDS) and digested with 1.25 mg/ml Proteinase K (Roche) for 60 min at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... including 5 μL template using LightCycler Multiplex RNA Virus Master (Roche, Switzerland). All assays were carried out in triplicate on the Roche Lightcycler 96 platform (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was digested with DNase-free RNase (5 μg/ml, Roche #11119915001) for 1 hour at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% Glycerol and EDTA free protease inhibitor cocktail tablet/50ml (Roche, UK)] ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA) with freshly added protease inhibitor cocktail (Roche, cat #11836170001). Lysates were passed through a 26G syringe and protein was quantified by DC Protein Assay (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM β-mercaptoethanol (buffer A) with Complete protease inhibitor cocktail (Roche) and 2 mg DNAse I from bovine pancreas (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μM LMD-009 and EDTA-free protease inhibitor cocktail tablets (Roche). Then the suspension was incubated at room temperature for 1.5 h after adding apyrase (25 mU/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM NaF and 5 mM Na3VO4) containing protease/phosphatase inhibitors (Roche). Cells were incubated in lysis buffer for 2-3 hours in rotator at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% glycerol (v/v%)) and dispensed into white 96-well plates (Roche). Compound (1 mM ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 μL of FastStart SYBR Green Master (Roche Diagnostics, Indianapolis, IN USA), 0.4 μL of qRT-PCR primers (Table S1) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Blocking was performed with 5 % Bovine serum albumin (Boehringer Mannheim, now Roche) in 1x PBST (1x PBS with 0.05 % Tween-20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5µL SYBR Green I Master mix (5 mL: Roche Diagnostics, Indianapolis, IN) and 2 µL of distilled and deionized H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 µL of 5 µM dT overhang adapter (Roche, cat. no. KK8727) was used for the End Prep reaction ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were blocked in 5% BSA (Roche, 10 735 086 001) in TBS-T before overnight incubation at 4°C with primary antibodies ...
-
bioRxiv - Genomics 2023Quote: ... and 0.08U KAPA2G Robust HotStart DNA Polymerase (5 U/mL, Roche KK5517). PCR reactions were performed using a thermocycler with the following conditions ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...