Labshake search
Citations for Roche :
2201 - 2250 of 8748 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cell Biology 2020Quote: Cell lysis was carried out in MES-lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) by beating using a Fast Prep 24 instrument (MP Biomedicals ...
-
bioRxiv - Cell Biology 2020Quote: ... was carried out using MES lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 mM NaCl; 1 mM EDTA, 1% Triton-X or 0.1% NP-40; supplemented with Complete Mini protease inhibitors, Roche). Cell lysates were cleared by centrifugation (3x 10 min at 20000 g at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the resulting crude synaptosome fraction was then resuspended in IP buffer (50 mM Tris pH 7,4; 100 mM NaCl; 1 mM EDTA, 1% Triton-X; supplemented with Complete Mini protease inhibitors, Roche) and cleared by 3x centrifugation at 20000 g ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% Triton X-100 and 0.1% SDS) with a protease inhibitor cocktail (Roche/1 tablet in 10 mL RIPA). Homogenates were centrifuged for 5 min at 4°C at 13,000 x G ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5% NP-40 and 1 mM EDTA supplemented with 1 × protease inhibitor complete mini EDTA-free cocktail from Roche). The supernatants of cell lysates were boiled for 5 min in 1 × SDS loading buffer (6 × ...
-
bioRxiv - Physiology 2020Quote: ... buffer (10 mM Tris [pH 7.5], 1 mM EDTA, 250 mM sucrose, 1 mM dithiothreitol [DTT], plus protease and phosphatase inhibitor cocktail [Roche]). Homogenates were centrifuged at 100,000 ×g for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% v/v NP-40, 0.1% w/v SDS, 1% w/v sodium deoxycholate, 1× complete mini-protease mixture; Roche), and incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... pH = 7.6; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1% Nonidet P40 Substitute; protease inhibitor cocktail [Roche]; PhosSTOP [Roche]), using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were treated with a commercially available collagenase/dispase mixture (1 mg·ml-1, 269638, Roche Diagnostics, Mannheim, Germany) and hyaluronidase (1 mg·ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.4) supplemented with 1 % Triton X-100 and protease inhibitor (Roche, 1 tablet per 100 ml lysis buffer) by gentle rocking at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: VcanTg(Hoxa1)1Chm (Vcanhdf) mice [25] (Figure-1 Supplement 1) were obtained under a material transfer agreement from Roche. Generation of Has1−/−;Has3−/− double knockout mice was described previously [67] ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended with 1 mL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl PH7.0, freshly added 1 mM PMSF, complete protease inhibitor [Roche]) for 10 min at 4°C and subjected to sonication to fragment the genomic DNA in size range of 300-700 base pair ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were then incubated in the blocking solution [1% Bovine Serum Albumin (Roche, Cat. No. 9048-49-1), 5% Normal Goat Serum (Thermoscientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 mM MgCl2, 10% glycerol, 300 mM NaCl, 0.2 U/mL DNase 1, 1 mM PMSF, complete proteinase inhibitor mixture; Roche) and homogenized with an EmulsiFlex for 20 min ...
-
bioRxiv - Biochemistry 2022Quote: ... the cells from each dish were then suspended in 300 μL of isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol) supplemented by 1 mg.mL-1 final lysozyme concentration and protease inhibitors (cOmplete, EDTA-free protease inhibitor cocktail, Roche). Clarified lysates were loaded onto a 5 mL HiTrap FF column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... The crude nuclei pellet was washed in 500 μL of isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche)) supplemented with 0.15% NP-40 ...
-
bioRxiv - Biochemistry 2022Quote: ... resuspended with precooled 1 mL isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche) per 10 mL buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... BRB80 buffer (80 mM Pipes pH 6.8, 1 mM MgCl2, 1 mM EGTA) supplemented with 1X protease inhibitors (Roche), and their ovaries were extracted with pre-cleaned forceps ...
-
bioRxiv - Cell Biology 2022Quote: ... A single-cell solution was obtained by tissue digestion using 1mgml−1 collagenase D and 0.1mgml−1 DNase I (Roche) in HBSS (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... Cells were spun down again and the pellet resuspended in 1.25 ml cold lysis buffer (PBS containing 1% TX-100, 1 mM NEM, and Complete Protease Inhibitor from Roche). Cells were lysed for 30 minutes on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... mitochondria were lysed in lysis buffer (50 mM Tris pH 7.4, 100 mM KCl, 1 mM EDTA, 1× Complete Protease Inhibitor cocktail (Roche), 1mM PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... cells were lysed with lysis buffer (final concentration: 50 μg ml−1 lysozyme, 0.8% NP-40, 1 × protease inhibitor (Roche), 250 U ml−1 benzonase ...
-
bioRxiv - Genetics 2019Quote: Cells were lysed with modified RIPA (50 mM Tris-HCL, 1% NP40, 0.25% Na-deoxycholate, 150 mM NaCl, and 1 mM EDTA; CompleteTM Protease Inhibitor Cocktail [Roche]), and protein concentrations were determined with the BCA-Kit (Pierce) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... cells were lysed with 100 µl Lysis buffer (10 mM Tris-HCl, pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, Protease Inhibitor Cocktail Roche). The cell pellet was resuspended by pipetting and incubated on ice for 30 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mM Na3VO4 and supplemented with a protease inhibitor cocktail (1 tablets to 10 ml of lysis buffer, Roche) for 30 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... in a 1:1 volume ratio of Tris-buffered saline (pH 8.0) with added proteinase inhibitors (EDTA-free; Roche). Sample homogenization was confirmed by microscopic inspection ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Microbiology 2020Quote: ... 150 mM NaCl; 10 mM EDTA; 0.1% SDS; 1% Triton X-100; 1% deoxycholate; 1x complete protease inhibitor cocktail [Roche]), clarified and 20 μg total protein were used for SDS-PAGE followed by electroblotting ...
-
bioRxiv - Developmental Biology 2020Quote: ... Whole cells extract was isolated using RIPA buffer (NaCl 150mM – Tris HCL pH7,35 50mM – DOC 1% – N-P40 1% – H2O) supplemented with protease inhibitor (04 693 116 001, Roche). Isolated protein concentration was determined using Bradford assay (500-0006 ...
-
bioRxiv - Neuroscience 2022Quote: ... previously equilibrated in Wash buffer 1 (50 mM Tris-HCl pH 7.5, 150 nM NaCl, 1% NP-40, 1x protease inhibitors (Roche)) for 3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ml urea buffer (8M urea, 1mM EDTA, 10mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) was then added and the sample was gently mixed ...
-
bioRxiv - Cancer Biology 2022Quote: ... whole-cell extracts were prepared by lysing cells in buffer X (50 mM Tris pH 8.5, 250 mM NaCl, 1 mM EDTA, 1% NP-40, protease inhibitor minitablet (Roche)) and quantified using Bradford assay (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... Frozen bacteria containing full-length or ΔUBLΔUBA UBQLN constructs were resuspended in Buffer A (50 mM Tris pH 8, 1 mM MgCl2, 1 mM PMSF, and 0.2 mg/mL DNase I and Roche Complete Mini protease inhibitor cocktail) ...
-
bioRxiv - Genomics 2022Quote: ... before being re-pelleted by centrifuging for 3 minutes at 4°C at 500g and resuspended in 180µl TMS buffer (10mM Tris-HCl pH 8, 1mM MgCl2, 1% SDS, 1× Complete Protease Inhibitor Cocktail (PIC, Roche)) with 0.4µl benzonase (E1014 ...
-
bioRxiv - Genetics 2022Quote: ... pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, Complete EDTA-free protease inhibitor cocktail tablets, Roche) with half volume of glass beads (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... the cells were lysed with ChIP-Lysis buffer (10 mM EDTA, 1% [w/v] SDS, 50mM Tris-HCl, pH 7.5, 1 tablet Protease Inhibitor Cocktail [#11836170001; Roche, Mannheim ...
-
bioRxiv - Plant Biology 2022Quote: ... 150mM NaCl, 1mM EGTA, 50mM HEPES, pH 7.5, 1 mM PMSF and 1× cOmplete protease inhibitor cocktail from Roche). 30 μl GST beads (Glutathione Sepharose 4 Fast Flow ...
-
bioRxiv - Plant Biology 2022Quote: The samples were ground in liquid nitrogen and homogenized in the extraction buffer (100 mM Tris-HCl pH 8.8, 150 mM NaCl, 1 mM EDTA, 20% glycerol, 1 mM PMSF, 1x cOmplete protease inhibitor cocktail from Roche, 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Systems Biology 2022Quote: ... 6 mM MgCl2, 1 mM EDTA, 100 mM NaCl, 0.1% Tx-100, pH 8, and 1× Protease Inhibitor Cocktail, Roche) at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to the indicated samples in Pull-down Buffer 1 containing 1% (w:v) BSA supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche) (final volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... then resuspended in cytoplasmic lysis buffer (25 mM Tris–HCl pH 7.5, 10 mM NaCl, 1.5 mM MgCl2, 1% IGEPAL CA-630, and 1× protease inhibitor cocktail [“PI”, Roche 11836170001]) at 4°C and incubated on ice for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 mM NaCl, 0.5% Triton X-100, 1 mM DTT, 150 μM ZnSO4, 1 mM PMSF, 1xEDTA-free protease inhibitors [Roche]) overnight on a rotating wheel at 4 °C ...