Labshake search
Citations for Roche :
2051 - 2100 of 8293 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 1× complete proteinase inhibitor cocktail (Roche, 11873580001)) 41 and sorted by Becton Dickinson FACS Aria III flow cytometer (Becton ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: ... or 1:500 rat anti-HA (Roche, Cat#1215817001 ...
-
bioRxiv - Plant Biology 2024Quote: ... and 1/5000 anti-His (11667475001, Roche) for GFP and His-Tag detection ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:100 Protease Inhibitor Complete (Roche; 1183617000)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% Triton and 1x cOmplete solution (Roche). Total protein concentration was measured via Bradford assay ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat anti-HA (1:1000, #11867423001, Roche), Rat anti-NCAD (1:20 ...
-
bioRxiv - Cell Biology 2024Quote: ... NP40 1% and protease inhibitors (Roche # 04693132001) pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT and protease inhibitors (Roche) and sonicated 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... 1% NonidentP40) containing protease inhibitors (cOmplete; Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% sodium orthovandate (sigma) containing protease (Roche) and phosphatase inhibitor cocktail) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 X complete protease inhibitor (Roche), for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-GFP (1:3000, Roche, cat # 1814460001) and anti-Flag (1:3000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... levamisole 1 mM) containing NBT/BCIP (Roche). The background colour was removed by a series of washes in EtOH/PBSTw (30%/70% ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 100 units/ml DNAse 1 (Roche). Samples were then washed a second time ...
-
bioRxiv - Cell Biology 2024Quote: ... monoclonal anti-GFP (1/1,000, Roche, 11814460001), polyclonal anti-Dnm1 (1/1,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... solution containing 1 μM of Y27362 (Roche), washed and digested for an additional 30 minutes in 0.25% trypsin (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... and 0.5 mg.mL-1 DNAseI (Roche, 11284932001) solution in RPMI1640 for 45 minutes at 37°C and dissociated using GentleMACS (Miltenyi ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 1% protease inhibitor cocktail (Roche) and incubated on ice for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-HA (rat, 1:500, 11867423001, Roche), anti-MYO7A (rabbit ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cell Biology 2020Quote: Cell lysis was carried out in MES-lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) by beating using a Fast Prep 24 instrument (MP Biomedicals ...
-
bioRxiv - Cell Biology 2020Quote: ... was carried out using MES lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 mM NaCl; 1 mM EDTA, 1% Triton-X or 0.1% NP-40; supplemented with Complete Mini protease inhibitors, Roche). Cell lysates were cleared by centrifugation (3x 10 min at 20000 g at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the resulting crude synaptosome fraction was then resuspended in IP buffer (50 mM Tris pH 7,4; 100 mM NaCl; 1 mM EDTA, 1% Triton-X; supplemented with Complete Mini protease inhibitors, Roche) and cleared by 3x centrifugation at 20000 g ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% Triton X-100 and 0.1% SDS) with a protease inhibitor cocktail (Roche/1 tablet in 10 mL RIPA). Homogenates were centrifuged for 5 min at 4°C at 13,000 x G ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5% NP-40 and 1 mM EDTA supplemented with 1 × protease inhibitor complete mini EDTA-free cocktail from Roche). The supernatants of cell lysates were boiled for 5 min in 1 × SDS loading buffer (6 × ...
-
bioRxiv - Physiology 2020Quote: ... buffer (10 mM Tris [pH 7.5], 1 mM EDTA, 250 mM sucrose, 1 mM dithiothreitol [DTT], plus protease and phosphatase inhibitor cocktail [Roche]). Homogenates were centrifuged at 100,000 ×g for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% v/v NP-40, 0.1% w/v SDS, 1% w/v sodium deoxycholate, 1× complete mini-protease mixture; Roche), and incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... pH = 7.6; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1% Nonidet P40 Substitute; protease inhibitor cocktail [Roche]; PhosSTOP [Roche]), using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were treated with a commercially available collagenase/dispase mixture (1 mg·ml-1, 269638, Roche Diagnostics, Mannheim, Germany) and hyaluronidase (1 mg·ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.4) supplemented with 1 % Triton X-100 and protease inhibitor (Roche, 1 tablet per 100 ml lysis buffer) by gentle rocking at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: VcanTg(Hoxa1)1Chm (Vcanhdf) mice [25] (Figure-1 Supplement 1) were obtained under a material transfer agreement from Roche. Generation of Has1−/−;Has3−/− double knockout mice was described previously [67] ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended with 1 mL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl PH7.0, freshly added 1 mM PMSF, complete protease inhibitor [Roche]) for 10 min at 4°C and subjected to sonication to fragment the genomic DNA in size range of 300-700 base pair ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were then incubated in the blocking solution [1% Bovine Serum Albumin (Roche, Cat. No. 9048-49-1), 5% Normal Goat Serum (Thermoscientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 mM MgCl2, 10% glycerol, 300 mM NaCl, 0.2 U/mL DNase 1, 1 mM PMSF, complete proteinase inhibitor mixture; Roche) and homogenized with an EmulsiFlex for 20 min ...
-
bioRxiv - Biochemistry 2022Quote: ... the cells from each dish were then suspended in 300 μL of isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol) supplemented by 1 mg.mL-1 final lysozyme concentration and protease inhibitors (cOmplete, EDTA-free protease inhibitor cocktail, Roche). Clarified lysates were loaded onto a 5 mL HiTrap FF column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... The crude nuclei pellet was washed in 500 μL of isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche)) supplemented with 0.15% NP-40 ...
-
bioRxiv - Biochemistry 2022Quote: ... resuspended with precooled 1 mL isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche) per 10 mL buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... BRB80 buffer (80 mM Pipes pH 6.8, 1 mM MgCl2, 1 mM EGTA) supplemented with 1X protease inhibitors (Roche), and their ovaries were extracted with pre-cleaned forceps ...