Labshake search
Citations for Roche :
2151 - 2200 of 2542 citations for Mouse anti Rift Valley Fever Virus Nucleoprotein M977 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with HRP-conjugated rabbit anti-sheep antibodies and detection using ECL reagents (Roche Diagnostic GmbH). A series of timed exposures were undertaken to ensure that densitometric analyses were performed at exposures within the linear range ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated in alkaline phosphatase-conjugated anti-DIG (Digoxygenin) antibody Fab fragments (1:5000; Roche, catalog #12486523) at 1:5000 in the blocking buffer and incubated at 4°C overnight ...
-
bioRxiv - Physiology 2020Quote: ... The sections were incubated with sheep anti-DIG antibody (1:200, Roche Applied Science; cat. no 1333 089), biotinylated donkey anti-sheep antibody (1:200 ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were transferred to PVDF membranes and labelled overnight with anti-HA (0.01 μg/mL, Roche clone 3F10), anti-VE-Cadherin (0.5 μg.ml−1 ...
-
bioRxiv - Neuroscience 2019Quote: ... In situ hybridization signals were detected with sheep anti-digoxigenin-AP Fab fragments (1:10,000; Roche Diagnostics, Germany). The color staining was carried out with chromogen substrates (nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate ...
-
bioRxiv - Zoology 2019Quote: ... After incubation at room temperature for 4 hours in 1:2000 dilution of anti-digoxigenin antibody (Roche #11376623) prepared in TBST containing 10% FBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the samples were washed in 0.1M glycine pH 2.0 and then incubated overnight with anti-fluorescein (1:250) (Roche). Samples were then washed in TNT ...
-
bioRxiv - Biophysics 2021Quote: ... DNA with digoxigenin at one end was attached to the anti-digoxigenin (Roche Life Science, Indianapolis, IN, USA) coated-coverslips ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated with an alkaline phosphatase-conjugated anti-digoxigenin antibody (1:1500 in blocking solution; Roche, Switzerland) overnight at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... The incubation with the anti-digoxigenin-POD took place afterwards (1/2000 dilution in BSA/TBST, Roche Diagnostics) at room temperature for 3 h ...
-
bioRxiv - Biophysics 2021Quote: ... then assembled into flow chambers using double-sided tape and functionalized with 0.2 μM anti-DIG IgG (Roche), then passivated with 1% Pluronic F-127 in MRB80 ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% non-fat milk TBST and probed with primary anti-GFP (Roche, 1:1000) and secondary HRP- conjugated anti-mouse antibody (R&D Systems ...
-
bioRxiv - Microbiology 2020Quote: ... permeabilized and immunostained with the following primary antibodies - rat monoclonal anti-HA (clone 3F10, Roche: 1:250 dilution), mouse monoclonal anti-myc (clone 9B11 ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were incubated in PEMBALG containing monoclonal anti-HA antibody produced in rat (1:1000 dilution, Roche) for one hour ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Genomics 2022Quote: ... Slides were washed at 42°C in 0.1xSSC and hybridization sites were detected with anti-digoxigenin-FITC (2µg/ml; Roche) and Streptavidin-Alexa594 (1µg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with 40 µL of primary antibody (1:1,000 rat anti-HA mAb 3F10, Roche) at 4°C overnight in a solution containing 3% BSA in PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... Membranes were blocked with 5% milk dissolved in TBST and probed with primary anti-HA (Roche, 1:2000), anti-Flag (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The membranes were blocked using 10% skimmed milk in PBS containing 0.1% Tween 20 (PBST) and then incubated with rat anti-HA high affinity (1:1,000; Roche) and rabbit anti-T ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Developmental Biology 2019Quote: ... After a series of washes the probes were detected using FITC conjugated anti-Digoxigenin antibody (1:20, Roche) amplified with anti-sheep Alexa Fluor 488 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Plant Biology 2019Quote: ... The presence of the proteins of interest was tested by immunodetection using rat anti-HA-peroxidase (3F10, Roche) or chicken anti-c-Myc primary antibody (A2128 ...
-
bioRxiv - Cancer Biology 2019Quote: All A673/TR/shEF in vitro and xenograft proteins were extracted with RIPA and anti-protease cocktail (Roche). Western blots were hybridized with rabbit monoclonal anti-FLI1 antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and completed with anti-proteases (cOmplete™ ULTRA Tablets, Mini, EDTA-free, EASYpack Protease Inhibitor Cocktail, Roche®) and anti-phosphatases (PhosphoSTOP ...
-
bioRxiv - Immunology 2021Quote: ... The Roche Elecsys anti-SARS-CoV-2 assay was performed on Roche Cobas e411 (Roche Diagnostics, Indianapolis, IN). The Elecsys antinSARSnCoV-2 assay uses a recombinant protein representing the N antigen for the determination of antibodies against SARSnCoVn2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Neuroscience 2021Quote: ... In situ hybridization signals were detected with sheep anti-digoxigenin-AP Fab fragments (1:10000; Roche Diagnostics, Germany) conjugated with alkaline phosphatase ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG was detected with anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche, Indianapolis IN; 1:2000 dilution). Alkaline phosphatase activity was revealed using NBT/BCIP (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... the AAC2 variants were imported into Tom40-HA mitochondria followed by affinity purification via anti-HA beads (Roche) (18) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The bound ribopropbe was detected using an alkaline phosphatase-conjugated goat anti-DIG Fab fragment (1:750; Cat#: 11093274910, RRID:AB_514497; Roche) and the HNPP/FastRed detection kit (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... the whole-cell extracts and immunoprecipitates were subjected to western blotting using monoclonal anti-GFP (JL-8, Roche), Flag-M2 monoclonal antibody (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2023Quote: ... the brain sections were incubated with peroxidase (POD)-conjugated anti-FITC antibody (Roche Applied Science, Germany; 1:2,000) or POD-conjugated anti-Digoxigenin antibody (Roche Applied Science ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...