Labshake search
Citations for Roche :
2151 - 2200 of 8731 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 0.02% phenylmethylsulfonyl fluoride) with one complete protease inhibitor tablet (Roche diagnostics GmbH, Germany) and homogenized using a bead beater (40 seconds at speed 6 using the Fast-prep-24 bead beater ...
-
bioRxiv - Cell Biology 2022Quote: ... One microgram of RNA was used for cDNA synthesis with dNTPs (Kapa Biosystems), oligo(dT ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.1 % NP40 with one tab/10 ml of complete protease inhibitor cocktail (Roche). The solution was vortexed ...
-
bioRxiv - Neuroscience 2022Quote: ... and one protease inhibitor cocktail tablet (Cat# 11836153001, Roche Applied Science, Mannheim, Germany). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... pH 8.5) and with addition of one tablet cOmplete Protease Inhibitor Cocktail (Roche) and lysozyme incubated for 20-50 min at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and one tablet each of PhoStop and Complete Mini (04906845001 and 04693124001, Roche). Insoluble materials were removed by centrifugation at 300 × g for 20 min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... one ear was injected intradermally with 25µL of 100µg/mL alum hydroxide (Roche), and the contralateral ear was left untreated ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes (175 mg protein) were treated with one cOmplete protease inhibitor tablet (Roche) then solubilised on ice at 4.5 mg mL−1 by the stepwise addition of lauryl maltose neopentyl glycol (LMNG ...
-
bioRxiv - Microbiology 2023Quote: ... using the Transcriptor One-Step RT PCR Kit (Roche Applied Science, Mannheim, Germany). Sanger-sequencing (Sequencer 3130 Genetic Analyzer ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... from 4L of bacterial culture was resuspended in 30 mL lysis buffer (50 mM Tris-HCl pH 8.3, 1 mM EDTA, 150 mM NaCl, 10% glycerol, 5 mM DTT, 1 mM PMSF, and Roche protease inhibitor cocktail) and sonicated on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were gently resuspended in 25 ml of swelling solution (1 mM PIPES pH 7.0, 1 mM MgCl2, 5 μg/ml taxol and Roche Complete Protease Inhibitors) and immediately centrifuged at 250 g for 3 min ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.2% NP-40, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 20 µM MG132, 5 mM DTT and Roche protease inhibitor #5892953001), and incubated for 1 h on a rotating wheel ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Genetics 2019Quote: ... resuspended in 60 ml hypotonic lysis buffer (20 mM HEPES-KOH pH 7.5, 5 mM NaCl, 1 mM MgCl2, 1 mM PMSF and EDTA free protease inhibitor mixture from Roche and Thermo Scientific) and incubated for 15 min on ice ...
-
bioRxiv - Immunology 2019Quote: ... and hematoxylin (4 minute incubation) and Bluing Reagent (4 minute incubation) counterstain (Roche, Ventana Medical Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% (v/v) glycerol and 1 mM TCEP containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The membranes were blocked for 1 hour at room temperature with 5% blocking agent (Roche Diagnostic) in TBST (100 rpm shaker) ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.5 supplemented with 5 mM dithiothreitol (DTT) and 1 x cOmplete protease inhibitor cocktail (Roche)) per gram of wet cell paste and incubated for 1 h at 4°C under stirring ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM imidazole] containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Complete™; Roche), and recombinant proteins were purified by immobilized metal affinity chromatography (TALON ...
-
bioRxiv - Biochemistry 2024Quote: ... in 5 % BSA in room temperature for 1 hour followed by 2.5 ug/ml DAPI (Roche) for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... At the end of the cell disruption dry homogenised powder of cells were resuspended in 1 ml urea buffer (8 M urea, 50 mM Tris/HCl pH 8.0 containing one tablet of ‘cOmplete’ protease inhibitor per 25 ml, Roche, Germany; 1 mM DTT; 0.1 M PMSF) and centrifuged at 16,000 × g for 10 minutes at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:50 in dH2O and mixed with an equal volume of target-specific primers and Roche 2×SYBR master mix (Roche, Cat No.04707516001). Plates were centrifuged at 1000 rpm for 1 min and stored at 4°C in the dark until ready for use ...
-
bioRxiv - Developmental Biology 2022Quote: ... but with several differences from incubation with the anti-DIG antibody on: Incubation with blocking Buffer (2% Blocking Reagent from ROCHE in MABTween 1x) for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Genomics 2020Quote: ... SeqCap library preparation was performed using custom Nimblegen SeqCap probes (described above in §2.1) according to the NimbleGen SeqCap EZ HyperCap Workflow User’s Guide Ver 2 (Roche Sequencing Solutions, Inc., CA USA). Following capture ...
-
bioRxiv - Microbiology 2020Quote: Deidentified remnant patient samples that underwent routine clinical testing with the cobas SARS-CoV-2 assay on the 6800 platform (Roche Diagnostics, Indianapolis, IN) were used to evaluate the Xpert and ID Now assays ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...