Labshake search
Citations for Roche :
1951 - 2000 of 8731 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pancreas was perfused through the common bile duct with 2 mL of 0.8 mg/mL collagenase P (Roche, Indianapolis, IN) in Hanks’ balanced salt solution [HBSS] with Ca2+ and Mg2+ (Corning ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA samples were subsequently incubated for 20 min at 37 °C with 2 U of DNase I (Roche, Germany). The absence of DNA contamination in the samples was checked by the lack of conventional PCR amplification of the GP43 gene in the isolated RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was removed and the well was washed with 2 ml ice cold PBS before 100 μl lysis buffer were applied (RIPA buffer supplemented with PhosSTOP; Roche) and protease inhibitors (complete Mini ...
-
bioRxiv - Microbiology 2020Quote: The cell viability of circPSD3 siRNA treated cells was determined at day 2 post-transfection using Cell Proliferation Kit I (MTT, Roche) as previously described [59].
-
bioRxiv - Microbiology 2021Quote: ... The cell pellet was then resuspended in 300 μL of homogenization buffer (150 mM KCl, 20 mM HEPES pH 7.4, 2 mM EDTA, cOmplete Mini Protease Inhibitor Cocktail tablet-Roche 04693124001). For the unfractionated sample ...
-
bioRxiv - Cancer Biology 2020Quote: Tumors from MMTV-PyMT mice and C3(1)-Tag mice were resected and minced using a razor blade in DMEM containing 2 mg/mL collagenase and 100 U/mL hyaluronidase (Roche) in a rotator at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Pellets were thawed on ice and suspended in 2 mL of lysis buffer A (50 mM NaPO4, pH 7.3, 300 mM NaCl, 2 mM β-mercaptoethanol, 20% glycerol and Roche cOmplete protease inhibitor (1 tablet per 10 mL)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 µg of total RNA was converted to a sequence library using a KAPA Stranded mRNA-seq Kit (KAPA Biosystems). These libraries were analyzed using a HiSeq 2500 sequencer (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... cellular pellets were suspended in 10 mL of Buffer 1X supplemented with 2 mM (L+D) 1,4-Dithiothreitol (DTT) and cOmplete™ mini protease inhibitor cocktail (Roche). To avoid overheating and protein denaturation ...
-
bioRxiv - Cell Biology 2019Quote: ... washed in PBS, and resuspended in Lysis Buffer (Tris 10 mM pH 8, 2 mM EDTA) supplemented with Complete protease inhibitor (Roche, Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5X SSC, 100 µg/ml heparin, 100 µg/ml yeast RNA, 0.1% TritonX-100, 0.1% CHAPS, 2% Roche blocking reagent) for more than an hour at 60–65 °C ...
-
bioRxiv - Microbiology 2021Quote: ... GTP binding Irgb6 crystals diffracting to 1.5 Å resolution were obtained from sitting drops with a 9 mg/ml protein solution containing 2 mM GTP (Roche) and a reservoir solution consisting of 0.1 M Sodium Citrate buffer pH 5.4 (Wako) ...
-
bioRxiv - Genomics 2020Quote: Barcoded 2×300 bp metagenomic libraries were prepared with the KAPA Hyperplus Library Preparation kit (KAPA Biosystems, Wilmington, MA, US) and sequenced on an Illumina MiSeq system at the National Oceanography Centre (Southampton ...
-
bioRxiv - Cancer Biology 2021Quote: The in vitro synthesis of digoxigenin (DIG)-labeled antisense SatIII probe (158 bp SatIII repeat cloned in 1μg of PGEM-2-98 construct) with T7 RNA polymerase was carried out using the DIG labeling kit from Roche Products Pvt ...
-
bioRxiv - Immunology 2020Quote: ... Dissociation was performed with 150-200 embryos for each sample after 2 hours beclomethasone or vehicle treatment (started at 28 hpf) using Liberase TL (Roche) and stopped by adding Fetal Calf Serum (FCS ...
-
bioRxiv - Immunology 2020Quote: Age- and sex-matched mice were challenged by intravenous injection of CpG (2 μg premixed with 15 μl DOTAP (Roche) in DPBS ...
-
bioRxiv - Microbiology 2021Quote: ... and transfected with plasmid pIIIH5red-SARS-2-S DNA using X-tremeGENE HP DNA Transfection Reagent (Roche Diagnostics, Penzberg, Germany) according to the manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bisulfite-treated DNA was amplified by nested PCR (Supplementary Table 2) using KAPA HiFi HS Uracil+ ReadyMix (Kapa Biosystems). In the first and second rounds of PCR ...
-
bioRxiv - Genomics 2021Quote: Bisulfite converted DNA was amplified and barcoded in 50 µL PCR reaction (22 µL bisulfite-converted DNA, 25 µL 2× KAPA HiFi HotStart Uracil+ ReadyMix (Roche), 1.5 µL 10 µM i5 universal PCR primer ...
-
bioRxiv - Genomics 2021Quote: ... Early passage cells were seeded at 25% confluency in six-well plates and transfected with 2 ug of expression vector using Fugene reagent (Roche). Cells were harvested and seeded into 100 mm dishes after 48 h of transfection ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 ng of cDNA were amplified per reaction and each reaction was performed in triplicate using the LightCycler 384 (Roche) with SYBR Green Master Mix II (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 300 mM NaCl, 20% glycerol, 2 mM MgCl2, 0.2 mM EDTA, 0.1% NP40, 0.5 mM DTT and 1x Roche protease inhibitor cocktail) on a rotating wheel at 4° C for 1 h in triplicates with GFP-Trap agarose beads (#gta-200 ...
-
bioRxiv - Microbiology 2022Quote: ... and lysed by incubation for 30 min on ice in non-denaturing lysis buffer (300 mM NaCl, 100 mM Tris-HCl, pH 7.4, 2% Triton X-100, and 1x EDTA-free protease inhibitor cocktail [Roche Complete]). For immunoblot assays ...
-
bioRxiv - Microbiology 2022Quote: ... GTP-binding Irgb6-T95D crystals diffracting to 1.68 Å resolution were obtained from sitting drops with a 0.5 μl of protein solution containing 2 mM GTP (Roche) and a 0.5 μl of reservoir solution consisting of 0.2 M Sodium sulfate (Molecular Dimensions ...
-
bioRxiv - Plant Biology 2022Quote: Total protein extracts were prepared by re-suspending 100 mg of ground plant material in 100 μl of protein lysis buffer (50 mM Tris pH 8.0; 2% SDS; 10 mM EDTA; protease inhibitors (Roche (04693159001) cOmplete™ ...
-
bioRxiv - Neuroscience 2022Quote: One adult rat brain (2 g) was homogenized in nine volumes of 320 mM sucrose solution supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and Phosphatase Inhibitor Cocktail 1 and 2 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... eIF2αS/S and eIF2αA/A MEFs transduced with TauRD-YFP and Biosensor cell transfected with wild-type and PS19 brain lysates were lysed with SDS lysis buffer (2% SDS in PBS containing protease and phosphatase inhibitors (11836153001, Roche)) or RIPA buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then processed by immobilized metal affinity chromatography (IMAC) on a gravity column containing 2 mL bed volume of cOmplete His Tag purification resin (Roche). After loading the lysate ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were extracted from the tissue powder or synaptogliosome pellets in 2% SDS (500 µl or 200 µl per sample, respectively) with EDTA-free Complete Protease Inhibitor (Roche), sonicated twice for 5 min or once for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were collected by centrifugation and re-suspended in Binding Buffer (PBS containing: 2 x cOmplete EDTA-free protease inhibitor cocktail [Roche] ...
-
bioRxiv - Plant Biology 2023Quote: ... Glucose production rates were determined at 2 h using an Accu-Chek ®Aviva glucometer (Roche Diagnostics Scandinavia AB, Sweden). Monosaccharide (arabinose ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell pellet was resuspended and homogenized in buffer B supplemented with 2 mM MgCl2 and 1x protease inhibitor (Roche). The protein was extracted by incubating with 1% GDN (Anatrace ...
-
bioRxiv - Immunology 2023Quote: ... Kidneys were homogenized using the Miltenyi gentleMACS Dissociator and digested for 20 minutes at 37°C in RPMI with 2 mg/mL collagenase D (Roche) and 0.1 mg/mL DNAse I ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... coli cell pellets was carried out by resuspending pellets in 50 mL of lysis buffer (50 mM NaPO4, 300 mM NaCl, 20 mM imidazole, 10 mM 2-mercapoethanol, protease inhibitor (Roche), DNAse (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 ml of HBSS (without Ca2+ or Mg+) and 10 ml of collagenase solution [2 mg/ml collagenase H (11074059001; Roche), 0.1 mg/ml DNaseI (10104159001 ...
-
bioRxiv - Immunology 2023Quote: ... Tumors excised at day indicated in each figure were disaggregated mechanically and enzymatically with 2 mg/mL collagenase IV and 50 U/mL DNase I (Roche).
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then resuspended in 4x pellet volume of sucrose buffer (10 mM HEPES/KOH pH 7.5.; 2 mM MgAc; 250 mM Sucrose, 1x Protease inhibitor cocktail [Roche, Germany]) and lysed with ~50 strokes in a tight-fit dounce homogenizer ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed in lysis buffer (2% SDS in 50 uM Tris-HCL pH.8, supplemented with EDTA-free protease inhibitor, Roche) at cell concentration of 20×106/mL and incubated at 95 °C for 15 minutes ...
-
bioRxiv - Genomics 2022Quote: ... Re-purified circular fragments were amplified by PCR with View-Point specific primers (see Supplementary Table 2) using the Expand Long Template PCR System (Roche). Resulting amplicons were purified with a 0.8× ratio of AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell pellets resuspended in lysis buffer (purification buffer 50 mM Tris pH 8, 50 mM NaCl, 2 mM DTT; + cOmplete EDTA-free Protease Inhibitor (Roche)) and lysed by sonication ...
-
bioRxiv - Microbiology 2023Quote: ... The suspension medium was carefully removed and replaced with fresh PDB supplemented with 2× protease inhibitor (Mini Protease Inhibitor Cocktail, Roche), 0.5 mM or 2 mM PMSF (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... for all qPCRs except C9orf72 variant 2 expression levels for which TaqMan probes were used (sequences provided in Table S2) and measured with a LightCyclerTM (Roche). qPCR was performed in technical triplicate with data normalised to GAPDH expression levels.
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 4.5–6 μg of plasmid and dsRNA were transfected into BmN4 cells (∼2 × 106 cells per 10 cm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche). The second transfection was performed 3 days after the first transfection and the cells were harvested after an additional 5 days ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 mL dissociation buffer (RPMI-1640 (Cytiva) with 25 mM HEPES and 10 µg/mL gentamicin sulfate) supplemented with 2 mg/mL Collagenase-D (Roche) and 100 U DNaseI (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 3–5 μg of plasmid and dsRNA were transfected into BmN4 cells (∼2 × 106 cells per 10 cm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche). Transfection was repeated 2 days and 5 days after the first transfection and the cells were harvested after an additional 4 days ...
-
bioRxiv - Neuroscience 2023Quote: Hippocampi were homogenized in 500µl of RIPA medium lysis buffer (Beyotime, #P0013E-2) in the presence of protease inhibitor cocktail (Roche, #11836170001). Samples were centrifuged at 10,000 × g for 30 minutes ...