Labshake search
Citations for Roche :
2101 - 2150 of 6348 citations for HDM Fluorescent Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Bioengineering 2021Quote: ... P14 CD8+ T cells were activated for 24 h as described above and resuspended in T cell media + 30 U/ml rhIL-2 (Roche) at 2 × 106 cell/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... The skin was finely minced with a scalpel and placed for 30 min at 37 °C on a shaker in a digesting enzyme cocktail of 2 mg/ml Collagenase P (Roche), 2 mg/ml Dispase (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... 18 µl cleared cell lysate or brain homogenates (20-100 µg based on Tau aggregate content) were incubated with 2 µl 1 mg / ml pronase (Roche) at 37° C for one hour ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 mM EGTA) with Halt phosphatase buffer inhibitor (Fisher: PI78420) and Complete mini EDTA-free protease inhibitor (Roche: 4693159001). Samples were sonicated at low power (Qsonica Q55 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Each DNA sample was diluted to 1 ng/μL and 2 μL were used for amplification using PrimeTime Gene expression Master Mix (IDT) with LightCycler96 (Roche) instrument ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH] ...
-
bioRxiv - Cell Biology 2022Quote: ... pancreas was perfused through the common bile duct with 2 mL of 0.8 mg/mL collagenase P (Roche, Indianapolis, IN) in Hanks’ balanced salt solution [HBSS] with Ca2+ and Mg2+ (Corning ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... PDX tumors were minced with No.22 blades into 1-2 mm fragments then digested with 1mg/ml collagenase/dispase (Roche) for 30-40 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were in contact for 2 hours at room temperature with a mouse monoclonal primary antibody anti-BrdU (1/1000 dilution) (Roche), then rinsed and incubated for 30 min with a fluorescent secondary antibody Alexa-633nm goat anti-mouse (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA samples were subsequently incubated for 20 min at 37 °C with 2 U of DNase I (Roche, Germany). The absence of DNA contamination in the samples was checked by the lack of conventional PCR amplification of the GP43 gene in the isolated RNA ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... one organoid per condition was lysed with Urea Buffer (7M Urea, 2M Thiourea, 2% CHAPS, 1% DTT (w/v) and Complete protease inhibitor cocktail (Roche) in MilliQ water) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was removed and the well was washed with 2 ml ice cold PBS before 100 μl lysis buffer were applied (RIPA buffer supplemented with PhosSTOP; Roche) and protease inhibitors (complete Mini ...
-
bioRxiv - Genetics 2020Quote: ... Tissues were incubated with primary antibody in dbe+ buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 2 mM EDTA, 1% BSA, 0.05% digitonin with Roche cOmplete protease inhibitor) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 for 48h the cells were washed twice with PBS and then lysed in PBS/1% NP40 including the cOmplete protease inhibitor cocktail 2 (Roche) and phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The cell pellet was then resuspended in 300 μL of homogenization buffer (150 mM KCl, 20 mM HEPES pH 7.4, 2 mM EDTA, cOmplete Mini Protease Inhibitor Cocktail tablet-Roche 04693124001). For the unfractionated sample ...
-
bioRxiv - Cancer Biology 2020Quote: Tumors from MMTV-PyMT mice and C3(1)-Tag mice were resected and minced using a razor blade in DMEM containing 2 mg/mL collagenase and 100 U/mL hyaluronidase (Roche) in a rotator at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Pellets were thawed on ice and suspended in 2 mL of lysis buffer A (50 mM NaPO4, pH 7.3, 300 mM NaCl, 2 mM β-mercaptoethanol, 20% glycerol and Roche cOmplete protease inhibitor (1 tablet per 10 mL)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... cellular pellets were suspended in 10 mL of Buffer 1X supplemented with 2 mM (L+D) 1,4-Dithiothreitol (DTT) and cOmplete™ mini protease inhibitor cocktail (Roche). To avoid overheating and protein denaturation ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting supernatant is the soluble fraction and the insoluble fraction is generated by resuspending the pellet in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Roche), 0.5 mM PMSF ...
-
bioRxiv - Biochemistry 2019Quote: ... with buffer II with protease inhibitors (8 μg/ml Aprotinin, 10 μg/ml Leupeptin, 1 μg/ml Pepstatin, 1 mM PMSF and 2 tablets cOmplete Mini, EDTA free; Roche) and 2 times flash frozen in liquid Nitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Cell Biology 2019Quote: ... washed in PBS, and resuspended in Lysis Buffer (Tris 10 mM pH 8, 2 mM EDTA) supplemented with Complete protease inhibitor (Roche, Merck ...
-
bioRxiv - Physiology 2021Quote: ... fish were taken out of their chamber one by one for a 2-min chase protocol (Roche et al., 2013) and returned in their chamber for immediate measurement of to estimate their maximum metabolic rate MMR (Fig ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5X SSC, 100 µg/ml heparin, 100 µg/ml yeast RNA, 0.1% TritonX-100, 0.1% CHAPS, 2% Roche blocking reagent) for more than an hour at 60–65 °C ...
-
bioRxiv - Microbiology 2021Quote: ... GTP binding Irgb6 crystals diffracting to 1.5 Å resolution were obtained from sitting drops with a 9 mg/ml protein solution containing 2 mM GTP (Roche) and a reservoir solution consisting of 0.1 M Sodium Citrate buffer pH 5.4 (Wako) ...
-
bioRxiv - Microbiology 2021Quote: ... the trachea was catheterized and BAL was performed by 2 consecutive flushes of the lungs with 1 mL ice-cold PBS containing Complete Protease Inhibitor Cocktail (Roche). Cell density in BAL fluid (BALF ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science ...
-
bioRxiv - Immunology 2020Quote: ... Dissociation was performed with 150-200 embryos for each sample after 2 hours beclomethasone or vehicle treatment (started at 28 hpf) using Liberase TL (Roche) and stopped by adding Fetal Calf Serum (FCS ...
-
bioRxiv - Immunology 2020Quote: Age- and sex-matched mice were challenged by intravenous injection of CpG (2 μg premixed with 15 μl DOTAP (Roche) in DPBS ...
-
bioRxiv - Microbiology 2021Quote: ... and transfected with plasmid pIIIH5red-SARS-2-S DNA using X-tremeGENE HP DNA Transfection Reagent (Roche Diagnostics, Penzberg, Germany) according to the manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bisulfite-treated DNA was amplified by nested PCR (Supplementary Table 2) using KAPA HiFi HS Uracil+ ReadyMix (Kapa Biosystems). In the first and second rounds of PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Genomics 2021Quote: Bisulfite converted DNA was amplified and barcoded in 50 µL PCR reaction (22 µL bisulfite-converted DNA, 25 µL 2× KAPA HiFi HotStart Uracil+ ReadyMix (Roche), 1.5 µL 10 µM i5 universal PCR primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed once with PBS and resuspended in ice-cold WCE buffer (10 mM Tris-HCl, 1% NP-40, 2 mM MgCl2, benzonase, cOmplete Protease Inhibitor Cocktail (Roche), 25 nM NEM where relevant ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 ng of cDNA were amplified per reaction and each reaction was performed in triplicate using the LightCycler 384 (Roche) with SYBR Green Master Mix II (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed twice in cold 1× PBS and harvested in 2% SDS in 50 mM HEPES buffer with freshly added protease and phosphatase inhibitors (Roche). Cell lysates were sonicated and centrifuged for 15 min at 12000 ×g to remove the insoluble fraction ...