Labshake search
Citations for Roche :
2101 - 2150 of 8032 citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Cancer Biology 2019Quote: ... PBS was aspirated and 5 ml 0.25% pre-warmed trypsin-EDTA with 10 U/µl DNaseI (Roche) was added and put into a 37°C water bath for 30 minutes with gentle inversion every 5 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... the tryptic digests were cleaved by chymotrypsin (5 ng/μl, sequencing grade, Roche, in 25 mM AB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Microbiology 2023Quote: ... D311A 5’-ATA ATC CCA TTT GGC GAC GTC AAT G) using KAPA HiFi HotStart ReadyMix (Roche). Homozygous KI was confirmed by Sanger sequencing after amplification using primer SAM_Seq_Ex16_FW (5’-CAT GAA GGC TCT TCC TGC GTA A ...
-
bioRxiv - Cell Biology 2023Quote: ... or ELB buffer (250 mM NaCI, 5 mM EDTA, 50 mM HEPES, 0.1% Ipegal, Roche protease inhibitor) with sonication (Qsonica ...
-
bioRxiv - Genomics 2023Quote: ... Magnesium chloride was added to a final concentration of 5 mM and KAPA HiFi 2x ReadyMix (Roche) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were incubated one hour in 5% milk before adding the primary antibody (anti-HA 3F10, Roche 27573500 ...
-
bioRxiv - Neuroscience 2023Quote: ... homogenization buffer (0.32 M sucrose, 5 mM HEPES, in PBS pH=7.4, with protease inhibitor cocktail [Roche]) was added to hippocampi samples ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM Tris-HCl, pH 7.5; 5 mM EDTA; 0.5% Igepal-CA630; 1.0% Triton X-100; protease inhibitors [Roche]) and debris was removed by centrifugation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were soaked in blocking solution (5% sterile horse serum, 0.5% Roche western blocking reagent in TNTx) for two hours at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries or testis were added to 1 mL of cold lysis buffer (50 mM Tris-HCl pH 8.0, 0.2% NP-40, 150 mM NaCl, 5 mM EDTA, 0.1 mg/mL PMSF, Roche complete EDTA-free protease inhibitor tablet ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs were frozen in liquid nitrogen and stored at 80 °C or directly lysed with lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 0.5% NP40, 0.5% Triron-X100, 5% glycerol, 1x Roche Complete EDTA free inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF with 1 X protease inhibitors (Roche) and incubated with 5-10 μg of purified MBP-tagged anillin or GST-tagged importin-β protein on beads at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 X protease and 1 X phosphatase inhibitors (Roche), 10 % v/v glycerol) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HA tag (Roche 11666606001, 1:1,000 or 1:3,000), His tag (Abcam ab18184 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mg.mL−1 SDS) with Complete protease inhibitors (Roche). Equal amounts of protein (BCA protein assay ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 1 mg ml-1 collagenase/dispase (Roche) and 0.1 mg ml-1 DNase I (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM DTT and 1 × protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD68 (clone KP-1 at 1:20, Ventana- Roche), FOLR2 (OTI4G6 at 1:200 ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with collagenase D (1 mg ml−1, Roche) and DNase I (0.25 mg ml−1 ...
-
bioRxiv - Molecular Biology 2019Quote: 800 ng of each fluorescently labelled oligonucleotide probe pool (2 μl; MyTags or Roche Probes) were added to (26 μl ...
-
bioRxiv - Immunology 2019Quote: ... The lungs were removed and infiltrated with 2 mg/ml collagenase D (Roche, Indianapolis, Indiana) and 0.2 mg/ml DNase I (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were then digested by addition of 2 μL 20 mg/mL Proteinase K (Roche) and incubation for 2 h at 55° C ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was removed to 2 ml Eppendorf tubes and incubated with HA antibodies (Roche) for 30 min on a rotator at 4° ...
-
bioRxiv - Neuroscience 2019Quote: ... pellets were resuspended in Solution 2 supplemented with EDTA-free protease inhibitor cocktail (Roche Diagnostics), and deacetylase inhibitors (10 mM nicotinamide ...
-
bioRxiv - Microbiology 2020Quote: ... using DK2371 chromosomal DNA as a template and Expand polymerase with Expand buffer 2 (Roche)/ The mutant PCR library was first transformed into PY79 by natural competence ...
-
bioRxiv - Plant Biology 2020Quote: ... 2% Triton X-100 and cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland). Samples were heated at 70 °C for 15 min with 1 x Bolt LDS sample buffer (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... 10μM stock) and KAPA HiFi hotstart ready mix (2× solution, 12.5μl + 2.5μl H2O, Roche, KK2602). PCR conditions were ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in three volumes of TKE supplemented with 2 mM DTT and PIs (Roche cOmplete). The capsids were sedimented in BSA-coated centrifuge tubes at 110,000 g at 4°C for 20 min (TLA-120.2) ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... 150 mM NaCl) containing 2% Triton X-100 and EDTA-free protease inhibitor cocktail (Roche). The resulting samples were incubated for 1 h at 4°C and spun down twice at 20,800 x g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were cultured in complete media with 30 IU/mL IL-2 (Roche, 202-IL). Media containing IL-2 was replenished daily for 10 days ...