Labshake search
Citations for Roche :
2051 - 2100 of 3389 citations for 6 cyano 5 methoxy 12 methylindolo 2 3 a carbazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 5 mM ethylenediaminetetraacetic acid (pH 8.0)] containing protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) for 45 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked by incubation in 5% (w/v) milk power or 1 × Western Blocking Reagent (Roche) in Tris-buffered saline and 0.1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Cancer Biology 2019Quote: ... PBS was aspirated and 5 ml 0.25% pre-warmed trypsin-EDTA with 10 U/µl DNaseI (Roche) was added and put into a 37°C water bath for 30 minutes with gentle inversion every 5 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... the tryptic digests were cleaved by chymotrypsin (5 ng/μl, sequencing grade, Roche, in 25 mM AB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 μl of each forward and reverse primer (5 uM) and 10 μl SYBR green (Roche, 4707516001) were used for qPCR (30 sec at 98 °C and 19 cycles of 10 sec at 98 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs were frozen in liquid nitrogen and stored at 80 °C or directly lysed with lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 0.5% NP40, 0.5% Triron-X100, 5% glycerol, 1x Roche Complete EDTA free inhibitor cocktail ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The following primary antibodies were used: GCase (5 µg/mL; hGCase-1/23; mouse monoclonal; Roche [62]); LAMP1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were soaked in blocking solution (5% sterile horse serum, 0.5% Roche western blocking reagent in TNTx) for two hours at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries or testis were added to 1 mL of cold lysis buffer (50 mM Tris-HCl pH 8.0, 0.2% NP-40, 150 mM NaCl, 5 mM EDTA, 0.1 mg/mL PMSF, Roche complete EDTA-free protease inhibitor tablet ...
-
bioRxiv - Microbiology 2023Quote: ... D311A 5’-ATA ATC CCA TTT GGC GAC GTC AAT G) using KAPA HiFi HotStart ReadyMix (Roche). Homozygous KI was confirmed by Sanger sequencing after amplification using primer SAM_Seq_Ex16_FW (5’-CAT GAA GGC TCT TCC TGC GTA A ...
-
bioRxiv - Cell Biology 2023Quote: ... or ELB buffer (250 mM NaCI, 5 mM EDTA, 50 mM HEPES, 0.1% Ipegal, Roche protease inhibitor) with sonication (Qsonica ...
-
bioRxiv - Genomics 2023Quote: ... Magnesium chloride was added to a final concentration of 5 mM and KAPA HiFi 2x ReadyMix (Roche) was used ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were incubated one hour in 5% milk before adding the primary antibody (anti-HA 3F10, Roche 27573500 ...
-
bioRxiv - Neuroscience 2023Quote: ... homogenization buffer (0.32 M sucrose, 5 mM HEPES, in PBS pH=7.4, with protease inhibitor cocktail [Roche]) was added to hippocampi samples ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM Tris-HCl, pH 7.5; 5 mM EDTA; 0.5% Igepal-CA630; 1.0% Triton X-100; protease inhibitors [Roche]) and debris was removed by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... intestinal pieces were digested in 5% FBS medium (RPMI) supplemented with 1 mg/ml collagenase D (Roche) and 0.5 mg/ml DNase I (Sigma ...