Labshake search
Citations for Roche :
151 - 200 of 420 citations for 8 16 Pyranthrenedione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... pH 8) containing a cocktail of protease and phosphatase inhibitors (Roche Applied Science, Mannheim, Germany) was used to extract total proteins from tissue samples and CRC cell lines by its incubation with cell pellets for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 20 mM Tris pH 8) supplemented with 1 mg/mL of protease inhibitors (Roche). Cell lysates were sonicated for 10 cycles with Bioruptor Pico (Diagenode ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Systems Biology 2020Quote: ... Metagenomes were obtained by pyrosequencing fragments of the 16S rRNA gene on the GS Junior platform (454 Life Sciences, Roche Diagnostics). Then the sequence data were processed by replicating the bioinformatics workflow followed by Paroni Sterbini et al ...
-
bioRxiv - Genomics 2019Quote: ... Supplementary Table S3) including 18S-28S rDNA and 5S rDNA probes were labeled with biotin-16-dUTP (Biotin Nick Translation Mix, Roche, USA) and/or digoxigenin-11-dUTP (Dig Nick Translation Mix ...
-
bioRxiv - Cancer Biology 2020Quote: Real-time measurements of cell migration and invasion were performed using the CIM-Plate 16 module of an xCELLigence System RTCA DP real-time cell analyzer (Roche, UK). For invasion measurement ...
-
bioRxiv - Microbiology 2019Quote: ... and Southern hybridization with blaKPC and rep IncFIIK DIG-labelled probes (16) prepared using published primers (35,36) and the PCR DIG Probe Synthesis Kit (Roche, Mannheim, Germany) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: A 257 bp digoxigenin-labeled RNA probe was generated from a region spanning exons 1-3 of cat Dkk4 using a PCR-based template (cDNA from Stage 16 cat embryonic epidermal cells; CCCTGAGTGTTCTGGTTTT, AATATTGGGGTTGCATCTTCC) and in vitro transcription (Roche Diagnostics). 10 μ M paraffin-embedded sections were deparaffinized with xylenes and antigen retrieval using 0.01 M citrate buffer ...
-
bioRxiv - Microbiology 2019Quote: ... 4 μl of the cDNA sample together with 16 μl mastermix were combined and analyzed using a LightCycler Nano (Roche, Germany). The light cycler program was as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Riboprobes were hybridized for 16 hr at 65°C and embryos were incubated with anti-DIG-AP (Roche, dilution 1/4000) overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridization signals of probes labelled with digoxigenin-11-dUTP and biotin-16-dUTP were detected with antidigoxigenin conjugated to fluorescein isothiocyanate (FITC; Roche Diagnostics) and streptavidin conjugated to Alexa 594 or Alexa 647 (Life Technologies-Molecular Probes) ...
-
bioRxiv - Immunology 2022Quote: Purified DNA from mouse fecal pellets or sorted cells was subjected to 16S variable region 4 PCR amplification using barcoded 515F and 806R primers (47) and the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems), with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The V4–V5 regions of 16S rRNA gene were amplified using specific primers and libraries were constructed using the Hyper Library Preparation Kit from Kapa Biosystems (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR enriched (8-10 cycles) using the KAPA Hyper Library Preparation kit (KAPA Biosystems, #KK8504). eCLIP libraries were prepared as described above according to (Van Nostrand et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 mM Tris-HCl pH 8) supplemented with protease and phosphatase inhibitor cocktail (Roche Molecular Biochemicals), and at 4 °C with gentle shaking/tumbling for 30 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 mM Tris-HCl pH 8 supplemented with phosphatase and protease inhibitor cocktail tablets (Roche Diagnostics)) ...
-
bioRxiv - Neuroscience 2021Quote: ... 8 μL of each sample E3 was used directly for PCR as described above (KAPA Biosystems). Embryos were kept in 48-well plates until genotyping was achieved.
-
bioRxiv - Cell Biology 2019Quote: ... the slides were incubated for 5 h at 8°C with mouse anti-DIG antibody (Roche, Basel ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8) supplemented with protease inhibitors (1 tablet of complete protease inhibitor per 20 mL; Roche, Mannheim ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight cultures were diluted to OD600 = 0.1 and treated with 8 mM DTT (Roche, Mannheim, Germany) for up to 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... gDNA was amplified using SV40_NLS_seq_f and SV40_NLS_seq_r (Supplementary Table 8) primers using Kapa Hifi (Kapa Biosystems KK2602) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The pellet was resuspended in 8 mL of polysome buffer containing 1x Protease inhibitor Cocktail (Roche) and 1 mM PMSF ...
-
bioRxiv - Microbiology 2019Quote: ... 80mM EDTA pH 8 and complete EDTA-free protease inhibitor cocktail according to instructions (Roche, CH)) ...
-
bioRxiv - Immunology 2021Quote: ... 50 mM Tris-Cl (pH 8) supplemented with Complete Protease Inhibitor Cocktail tablet (Roche, Mannheim, Germany) and 1x Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 500 μL of extraction solution (8 M Urea, 25 mM NH4HCO3, Protease inhibitor (cOmplete tab, Roche Switzerland ...
-
bioRxiv - Developmental Biology 2023Quote: ... Each sample was lyzed in 200 mM HEPES buffer (pH 8) containing PhosSTOP phosphatase inhibitors (Roche), phosphatase inhibitor cocktail2 (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... pH 8) containing 10 mM Imidazole and supplemented with Protease Inhibitor Mixture (Complete, Roche Applied Science) for lysis at 4 °C by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1% Triton-X 100 at pH 8) supplemented with EDTA-free complete protease inhibitors (Roche, 56619600). Lysozyme was added to 1 mg/mL and lysate incubated for 20 min on ice ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA was extracted from 5-8 pairs of ovaries using an RNA extraction kit (Roche). 50 ng of total RNA was used to make cDNA using the Transcriptor First Strand cDNA Synthesis kit (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... HUVEC were pre-treated with siRNAs or drug for 24 hr prior to plating an equal cell number onto the microelectrode surface of the E-plate (E-plate 16, Roche Applied Science). Impedance readings were taken automatically every 5 min for 24 hr.
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Microbiology 2019Quote: ... The V3-V4 region of the 16S rRNA gene was PCR amplified using the KAPA HotStart PCR Kit (Kapa Biosystems, Wilmington, MA) with 10 µL Kappa HotStart Mastermix ...
-
bioRxiv - Genomics 2022Quote: ... The amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25□μl ...
-
bioRxiv - Microbiology 2023Quote: ... we amplified the V3-V4 hypervariable region of the 16S rRNA gene via PCR with Hifi Hotstart Readymix (Kapa Biosystems; Boston, MA), forward primer 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG CCT ACG GGN GGC WGC AG-3’ ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... 1 mM EDTA pH 8 and 1 tablet of protease inhibitor cocktail Roche cOmplete (Roche, Basel, Switzerland) and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissues were lysed with 8 M urea in PBS supplemented with protease and phosphatase inhibitor cocktail (Roche) at room temperature ...
-
bioRxiv - Plant Biology 2019Quote: ... the membrane was probed with a 1:20000 dilution of mouse anti-GFP antibody (JL-8, Roche) or mouse anti-alpha-tubulin antibody (B-511 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 mM Tris pH 8) containing protease inhibitors (Roche mini EDTA-free, 1 tablet in 10 ml) and phosphatase inhibitors (2mM Sodium Ortho-Vanadate ...
-
bioRxiv - Developmental Biology 2021Quote: ... we lysed samples in 8 μl of lysis buffer PBND containing 0.1 mg/ml Proteinase K (Roche) (Scavizzi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and lentivirus vectors at a 2:8:10 μg ratio to HEK293T cells using Xtreme-Gene9 (Roche) and lentivirus-containing supernatants were collected 72hr post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5 ml ice-cold 8 % (v/v) paraformaldehyde solution in vPBS containing EDTA-free protease inhibitor (Roche) or ice-cold 8% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.1 mM EDTA (pH 8)) supplemented with 2 mM Na3VO4 and complete protease inhibitor mixture (Roche). Lysates were first centrifuged at 4 °C for 15 min at 20.000 g and subsequently subjected to ultracentrifugation at 4° C for 30 min at 100.000 g ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by incubation (16 h at 4 °C) in the presence of 10 pM TBST containing complete TM protease inhibitor cocktail (Roche Pharma, Basel, Switzerland). The membranes were washed three times with TBS (150 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CaCo-2 and Vero cells seeded at a density of 5 × 103 cells and 7 x 103 per well in 200 μl media containing 10% FBS in a 16-well E-plate (Roche Applied Science, Germany), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... and then digested for 1 h at 37°C in a vigorously shaking solution consisting of 16 mg of Collagenase D (Roche, Pleasanton, CA, USA), 3.0 U of Dispase II (Roche) ...
-
bioRxiv - Microbiology 2023Quote: The absolute abundance of the 16S rRNA gene was measured on LightCycler® Roche 480 Real-time PCR instrument (Roche Inc., Basel, Switzerland). A total of 20 μL reaction system consisted of 10 μL LightCycler® 480 SYBR Green I Master Mix (2 × ...
-
bioRxiv - Molecular Biology 2021Quote: ... Final DNA concentration of 1μM and increasing concentrations of Stl (0.5-8 μM) were mixed with 1μg/ml poly(d[I-C]) (Roche) in EMSA buffer (50 mM Tris-HCl pH 8 ...