Labshake search
Citations for Roche :
1851 - 1900 of 2089 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Whole lung single cell suspensions were prepared by harvesting lung lobes into 5 ml HBSS with 40µl Liberase Tm (0.1 U/ml, Roche, Cat# 5401127001) and 20µl DNAse 1 (10mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... The signals were detected by 4-nitro-blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) in a humidified container for 72 h at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... and lysed with sonication in lysis buffer (50mM Hepes, 500mM NaCl, 1% Tween20, 5% Glycerol, half a tablet of cOmplete EDTA-free protease inhibitor cocktail [Roche]). The suspension was sonicated at 150J in intervals of 1.5secs for 20 sec total in ice ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... Larvae were dissociated using a combination of enzymatic disruption using Liberase (Roche, 05 401 119 001, 5 μg/mL final), DNaseI (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with protein lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 1 mM Mg2Cl, 1% NP40 and supplemented with protease inhibitor cocktail, Roche), incubated on ice for 20 minutes and spun at 10,000 g for 10 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were lysed with protein lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 1 mM Mg2Cl, 1% NP40 and supplemented with protease inhibitor cocktail, Roche), incubated on ice for 20 minutes and spun at 10,000 g for 10 min at 4 °C ...
-
bioRxiv - Systems Biology 2023Quote: ... supplemented with 0.5% Nonidet P 40 Substitute (NP40; Fluka Analytical) and cOmplete mini EDTA-free protease and PhosSTOP phosphatase inhibitor cocktails (Roche)] ...
-
bioRxiv - Plant Biology 2024Quote: ... A total of 5 mL of either test buffer supplemented with 1 mM phenylmethylsulfonyl fluoride and one protease inhibitor tablet (Roche) was then to resuspend the fine powder ...
-
bioRxiv - Genetics 2024Quote: ... Blots were then exposed to 2.5 pmol of 40-nt HPLC purified DNA oligonucleotides conjugated to digoxigenin (DIG) using the DIG Oligonucleotide Tailing Kit (Roche) hybridized to the nitrocellulose membrane at 60°C overnight (42°C for 2 h for 5S rRNA ...
-
bioRxiv - Plant Biology 2024Quote: ... qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x) kit (Roche) and gene-specific primers in a LightCycler 96 (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibodies were serially applied using the U DISCOVERY 5-Plex IF procedure and the following reagents and kits (all from Ventana Medical Systems, Roche): DISCOVERY inhibitor (760-4840) ...
-
bioRxiv - Cell Biology 2024Quote: ... then with 1 ml of Western blot buffer (2% SDS, 5% Glycerol, 50 mM Tris-HCl, 0.2 M EDTA + cOmplete protease inhibitor cocktail tablet (Roche, 11697498001) + PhosSTOP (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... Total 2.5 g powder of each sample was resuspended in 30-ml 1% TFA with 250 μl protease inhibitor cocktail (Roche) and then centrifuged at 12,000 ×g for 20 min at 4℃ ...
-
bioRxiv - Immunology 2024Quote: Human and murine cells were incubated in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 % NP-40, 5 % glycerol) containing 1X protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... Lobes were separated into clusters of 1-5 oocytes and the follicular layer was removed i) enzymatically with Liberase (Roche) and ii ...
-
bioRxiv - Immunology 2024Quote: ... LNs obtained from organ donors were submerged in 5 mL R10 media (RPMI + 10% FBS + 1% penicillin/streptomycin + 2mM L-glutamine) supplemented with 10U/mL DNase I (Roche), cleaned of visceral fat ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... Coralville, Iowa, USA) and 0.25 µl reverse primer (5 µM, IDT) and was analyzed on a LC480 instrument (Roche, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: C2C12 cell lysate was generated using 5 million cells in RIPA lysis buffer with protease/phosphatase inhibitors (Roche #11836145001 and #04906837001), and 20μg of protein was loaded on a denaturing SDS page gel for detection of the VGLL2-NCOA2 fusion ...
-
bioRxiv - Immunology 2020Quote: ... The proliferation rate of lymphocytes was measured using 5-Bromo-2-deoxyuridine (BrDU) assay as per the manufacturer instructions (Cell Proliferation ELISA BrDU, Roche, USA).
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were conducted in a 10-µL final volume with 5 µL of 2X FastStar Universal SyBR green Master (Roche, Switzerland), 1.5 µL of forward/reverse primer mix (Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... After that pelleted beads were gently resuspended in washing buffer containing 4xTBS, 5% NP-40, phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and washed 10 times with gentle agitation ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... The tissue was homogenized in homogenization buffer (20 mM HEPES, pH 7.4; 320 mM sucrose, 5 mM EDTA) supplemented with protease inhibitors (Roche, Cat #11697498001) using a glass Dounce homogenizer ...
-
bioRxiv - Plant Biology 2019Quote: ... Total proteins from 120 seedlings were extracted with 150 µL of extraction buffer (50 mM Tris-HCl pH 7.4, 80 mM NaCl, 0.1 % Tween 20, 10 % glycerol, 10 mM dithiothreitol, 2× Protease inhibitor cocktail [11873580001, Roche], 5 mM PMSF). Prior to protein quantification ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 cycles of primary PCR to amplify the region of interest was performed using 2 μL of DNeasy eluate (∼100–300 ng template) in a 5 μL Kapa HiFi HotStart polymerase reaction (Kapa Biosystems; for primers see Supplementary Data Set 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... before lysis in swelling buffer (5 mM PIPES pH8.0, 85mM KCl) freshly supplemented with 1x protease inhibitor cocktail (Roche, cat. 04693116001) and 0.5% NP-40 ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed twice in PBS and resuspended in 100 μL annexin V incubation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing 1% annexin V FLOUS (Roche Molecular Biochemicals) and 500 μg/μl PI stain ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tissue was then washed with PBST extensively (10 times or more for 5 minutes) before development with BM-purple (1ml peer well, Roche Diagnostics). Time of development was approximately 24 hours at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 148.5 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1x PhosSTOP Roche, 5x cOmplete protease inhibitor cocktail Roche, 1 mM DTT) using a cell scraper (TPP 99003) ...
-
bioRxiv - Microbiology 2022Quote: ... The capsids were suspended in sample buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, PIs [Roche cOmplete]), and adsorbed to nitrocellulose membranes (BioTrace™ ...
-
bioRxiv - Microbiology 2022Quote: The samples were lysed in Laemmli buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, bromophenol blue, PIs [Roche cOmplete]). The proteins were separated on linear 7.5 to 12% or 10 to 15% SDS-PAGE ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were re-suspended in 1 mL lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche) and were sonicated until the lysate became turbid ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.5% Triton X-100, 100 mM NaF, 1 mM ortho-vanadate, 2 mM EDTA, and a protease inhibitor cocktail [Roche 11836153001]). Lysates were vortexed and cleared by centrifugation (15,000 x g for 15 min at 4°C) ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were pelleted by centrifugation at 2500g for 5 minutes and resuspended in 880ul Nuclear Lysis Buffer (50mM Tris HCl, 10mM EDTA, 1% SDS, 1X protease inhibitors (Roche, 04693124001)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Neuroscience 2020Quote: ... nt 1280-1350 from sequence NM_008553 detected with the mASCL1 probe (Universal Probe Library probe #74, Roche, Cat.No. 04688970001; 5′-(Fam)-GGCAGCAG-(Dark Quencher)-3′) ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Telomeric repeats were probed by incubating the membrane with telomeric probe containing digoxigenin (5’CCCTAACCCTAACCCTAACCCTAA-DIG; Integrated DNA Technologies, Coralville, IA; Table S1) overnight at 42°C DIG Easy Hyb™ buffer (Roche). Blots were washed in 2X saline-sodium citrate (SSC ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...