Labshake search
Citations for Roche :
1751 - 1800 of 6956 citations for 6 IODO 2 PIPERAZIN 1 YL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: After blocking in 20% heat-inactivated sheep serum (Cat. # ZLI-9021, Beijing Zhongshan Jinqiao Biotechnology Company) and 2% blocking reagent (Cat. # 12039672910, Roche) for 1 h ...
-
bioRxiv - Genetics 2022Quote: ... 10 µl of each PCR product were run in 2% agarose gels alongside digoxigenin (DIG)-labeled size markers VII and VIII (Roche), for 16 hours at 50 V then transferred to a positively charged nylon membrane (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... The oligonucleotide pool was further amplified by mixing 12.5 μl KAPA HiFi HotStart 2× ReadyMix (KAPA Biosystems cat. no. KK2601), 0.75 μl of 10 μM forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 25 mM Tris pH 8.0, 0.05% SDS, 2 mM MgCl2, 10 U/ml benzonase, and cOmplete™ EDTA-free protease inhibitor cocktail [Roche, 27368400]). Extracts were then incubated on ice for 10 min before protein concentration was calculated by Bradford assay (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested with a cell scraper and lysed by adding 2 x TNI buffer 8 containing complete Ultra protease inhibitor (Roche) and Halt phosphatase inhibitor (Pierce) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Embryos were washed in diluted stop solution and PBS-X and then incubated with a blocking solution containing: 2% (w/v) blocking reagent (Roche), 0.15 M NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were lysed in lysis buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 10% glycerol, 2 mM DTT, 30 mM imidazole and complete EDTA-free protease inhibitors cocktail [Roche]) supplemented with 1 mM TCEP ...
-
bioRxiv - Developmental Biology 2019Quote: ... probes were synthesized at 37°C for 2-4 hrs in digoxigenin-synthesis reaction mixture with T3 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Plant Biology 2019Quote: Tissue samples were ground in liquid N2 and then approximately 200mg of powdered tissue was added to 2 µL of TriPure isolation reagent (Roche Life Science ...
-
bioRxiv - Developmental Biology 2021Quote: ... Template DNAs of interest (500 ng each) were transcribed in vitro during 2 hours at 37°C using SP6 RNA polymerase kit (Roche), followed by a 1 hr treatment with DNAse I (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were analyzed according to the manufacturer’s guidelines using the Elecsys Anti-SARS-CoV-2 assay on the Roche cobas e602 platform (Roche Diagnostics). A cut-off index (COI ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Cancer Biology 2020Quote: ... the cell pellet was subjected to a freezing-thawing step and resuspended in the lysis buffer [2% Nonidet P40 (NP40; 11332473001, Roche), 0.2% SDS (75746 ...
-
bioRxiv - Neuroscience 2019Quote: ... Clear supernatant was incubated with 2 ml of pre-equilibrated Ni-beads (cOmplete™ His-Tag Purification Resin, Roche, Switzerland) for 1 h and then transferred to a sigma column to be washed consecutively with His-binding buffer (50 mM HEPES pH 8.0 ...
-
bioRxiv - Physiology 2021Quote: ... and 400 ml of sample was placed in a 2-l wide-mouthed Erlenmeyer culture flask with 100 ml of freshly prepared blendzyme (Roche Liberase TM ...
-
bioRxiv - Microbiology 2020Quote: ... We collected the flow through and replaced the lysis buffer with crystallization buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 2 mM DTT (1,4-Dithiothreitol, Roche, Basel, Switzerland)) using a 10 kDa MWCO filter ...
-
bioRxiv - Plant Biology 2020Quote: ... the water was removed with a pipette and 75 μl of Luminol-Mastermix (2 μg/ml horseradish peroxidase (Type II, Roche), 5μM L-012 (WAKO chemicals) ...
-
bioRxiv - Plant Biology 2021Quote: ... Elicitation was performed with the indicated concentration of peptides and 2 μg/ml horseradish peroxidase (Type II, Roche, Penzberg, Germany) and 5μM L-012 (FUJIFILM Wako chemicals ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial pellets were resuspended in 20 ml of sodium phosphate buffer A (20 mM Na2HPO4 x 2 H2O, 500 mM NaCl with a protease inhibitor cocktail (Roche) each and cells were disrupted using a French Press (Sim-Aminco Spectronic Instruments ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...
-
bioRxiv - Molecular Biology 2021Quote: Cell lysates were prepared in 2× Laemmli loading buffer supplemented with cOmplete protease inhibitor and PhosSTOP phosphatase inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... femurs were cut roughly and incubated with 2 Wunsch units of Liberase TM and 1mg of Pronase (Sigma/Roche 10165921001) in 2ml Ca2+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... sectioned and stained with various primary antibodies (detailed in Table 2) on an automated system (Ventana Discovery Ultra, Roche, Switzerland). “Intensity” (as specified on Y axes in Figure 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were spun (420 RCF x 2 min on LCM-3000 plate centrifuge (Grant Instruments, Royston, UK) before analysis on the Light Cycler 480 (Roche). Samples were run for 50 cycles (10s at 95°C and 30s at 60°C) ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... hippocampi from each animal were homogenized in ice-cold Homogenization buffer (2 M sucrose, 500 mM HEPES (pH 7,4)) containing complete Protease Inhibitor (Roche/Sigma) and spun down for 10 min at 1000 x g at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... qPCRs were performed using specific primers for each gene (Supplementary Table 2) in Roche LightCycler 480 real-time PCR machine using Lightcycler 480 Sybr Green I Master kit (Roche). Actin was used as a reference gene (Supplementary Figure 1) ...
-
bioRxiv - Synthetic Biology 2022Quote: Pellets were lysed via sonication of a 33 percent (w/v) cell suspension in 10 mM Tris pH 7.5/2 mM CaCl2 with protease inhibitor (Roche, 11836170001), cleared with centrifugation at 4C ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was performed with 2 x Hieff qPCR SYBR Green Master Mix (Yeasen) and detected by LightCycle 480 Real-Time PCR machine (Roche). For RNA-seq ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell pellet was resuspended in cold extraction buffer (10 mM Tris pH 7.5, 2 mM NaV, 50 mM NaF, 50 mM β-glycerophosphate, PhosSTOP Phosphatase inhibitor (Roche), cOmplete EDTA-free Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Membranes were UV crosslinked with 120 mJ/cm2 twice and then pre-hybridized for 2 hrs using DIG Easy Hyb (Roche). Fluorescent end-labeled oligos to the exons of tRNA-R1 were obtained from IDT (See Table S3) ...
-
bioRxiv - Neuroscience 2020Quote: ... To lyse the cells medium was removed and the well was washed with 2 ml ice cold PBS before 100 µl lysis buffer was applied (RIPA buffer supplemented with PhosSTOP (Roche) and protease inhibitors (cOmplete Mini ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM EDTA) supplemented with a cocktail of protease inhibitors (Complete Protease Inhibitor without EDTA, Roche Applied Science, Indianapolis, IN) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 3 ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Bioengineering 2021Quote: ... P14 CD8+ T cells were activated for 24 h as described above and resuspended in T cell media + 30 U/ml rhIL-2 (Roche) at 2 × 106 cell/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... The skin was finely minced with a scalpel and placed for 30 min at 37 °C on a shaker in a digesting enzyme cocktail of 2 mg/ml Collagenase P (Roche), 2 mg/ml Dispase (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 mM EGTA) with Halt phosphatase buffer inhibitor (Fisher: PI78420) and Complete mini EDTA-free protease inhibitor (Roche: 4693159001). Samples were sonicated at low power (Qsonica Q55 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pancreas was perfused through the common bile duct with 2 mL of 0.8 mg/mL collagenase P (Roche, Indianapolis, IN) in Hanks’ balanced salt solution [HBSS] with Ca2+ and Mg2+ (Corning ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA samples were subsequently incubated for 20 min at 37 °C with 2 U of DNase I (Roche, Germany). The absence of DNA contamination in the samples was checked by the lack of conventional PCR amplification of the GP43 gene in the isolated RNA ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was removed and the well was washed with 2 ml ice cold PBS before 100 μl lysis buffer were applied (RIPA buffer supplemented with PhosSTOP; Roche) and protease inhibitors (complete Mini ...